Hi Alexandra,

Well, if it is indeed a cipher (has that been established?) it would seem to me
that your first steps have been sensible and correct, ie
1) look at the source
2) treat the string therein as ACGT bases
3) translate them using the standard alphabet
but then I think you are trying to apply a Caesar or a Vigenere too early. Why?
Well, if you had a 212-letter ciphertext, fair enough. But what you actually
have is a 29-letter CT, repeated 7 times, then 5 letters, repeating the last 5
of each line, then 4 letters, repeating the first 4 of the 5. So surely (well,
actually, not surely at all!) the next step is to find the reason behind this
pattern......

....of course, I'm often completely wrong about such things... :-) :-)

Tim


________________________________

From: Alexandra Fiona Dixon [mailto:alexandra@...]
Sent: Fri 15-Jun-07 1:32 PM
To: CipherChallenge@yahoogroups.com
Subject: Re: [CipherChallenge] Genome Cipher?



No, it doesn't. But the surface page says to be re-source-ful (source is in
italics)...and it's the only thing that seems at all covert on the page.
The surface page shows dots, but the source code shows bases.

So, it's either that, or I'm missing something else!

----- Original Message -----
From: "John Lobert" <johnlobert@...
<mailto:johnlobert%40sbcglobal.net> >
To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%40yahoogroups.com>
>
Sent: Thursday, June 14, 2007 8:18 PM
Subject: Re: [CipherChallenge] Genome Cipher?

> Alexandra,
>
> Does it have to be anything more than it appears to be, DNA bases?
>
> John
>
> Alexandra Fiona Dixon <alexandra@... <mailto:alexandra%40t-hunts.com>
> wrote:
> Hey everybody, long time, no key.
>
> So, I was looking at the web site of a company called 23andme.com.
> This page http://www.23andme.com/jobs.html <http://www.23andme.com/jobs.html>
gives a hint that you
> should look at the source code.
>
> This company is owned by Anne Wojcicki, who just married Sergey Brin
> of Google (who played on my treasure hunt team a couple of times a
> few years ago). He loves puzzles, and in fact they screen potential
> employees at Google by hiding puzzles and ciphers that they have to
> find and solve in order to apply. So, I wasn't surprised to see
> something like this on her web site.
>
> I looked at the source code and it looks normal except that the dots
> that appear at the bottom of the visible page are actually a string
> of DNA bases, as follows:
>
> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
> CAGGAACTTCCACACC
>
> I turned this into 3-base codons, and then into the standard letter
> substitutions that represent each codon, and got a 212 letter string
> that is basically the same 29 letter string repeating over and over,
> with a bit left over at the end:
>
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> ELPHQELPH
>
> Thinking it might be either a Caesar shift or a Vigenere, I tried
> the shift (bubkus) and then tried various keys for Vigenere - DNA,
> Genome, 23andme, etc. Nothing turned up anything. Those are the
> only keys I have found, and I haven't looked at Playfair yet.
>
> I'm not applying for a job there, I'm just curious about what is
> hidden on the page - maybe it's not even the ACGT string!
>
> Alexandra
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>






[Non-text portions of this message have been removed]