Oh, you're right! How did I miss that?

Well, maybe it would be worthwhile to start building codons from the 2nd
position.

Nope, tried that. And third.

----- Original Message -----
From: "Tim Roberts" <t.roberts@...>
To: <CipherChallenge@yahoogroups.com>
Sent: Friday, June 15, 2007 12:24 AM
Subject: RE: [CipherChallenge] Genome Cipher?


>
> Alexandra,
>
> Oh! There are 637 letters, not 636! So surely this just about rules out
> a cipher made up of codons....?
>
> Tim
>
> ________________________________
>
> From: Tim Roberts [mailto:t.roberts@...]
> Sent: Fri 15-Jun-07 4:39 PM
> To: CipherChallenge@yahoogroups.com
> Subject: RE: [CipherChallenge] Genome Cipher?
>
>
>
> Hi Alexandra,
>
> Well, if it is indeed a cipher (has that been established?) it would seem
> to me that your first steps have been sensible and correct, ie
> 1) look at the source
> 2) treat the string therein as ACGT bases
> 3) translate them using the standard alphabet
> but then I think you are trying to apply a Caesar or a Vigenere too early.
> Why? Well, if you had a 212-letter ciphertext, fair enough. But what you
> actually have is a 29-letter CT, repeated 7 times, then 5 letters,
> repeating the last 5 of each line, then 4 letters, repeating the first 4
> of the 5. So surely (well, actually, not surely at all!) the next step is
> to find the reason behind this pattern......
>
> ....of course, I'm often completely wrong about such things... :-) :-)
>
> Tim
>
>
> ________________________________
>
> From: Alexandra Fiona Dixon [mailto:alexandra@...
> <mailto:alexandra%40t-hunts.com> ]
> Sent: Fri 15-Jun-07 1:32 PM
> To: CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>
> Subject: Re: [CipherChallenge] Genome Cipher?
>
> No, it doesn't. But the surface page says to be re-source-ful (source is
> in
> italics)...and it's the only thing that seems at all covert on the page.
> The surface page shows dots, but the source code shows bases.
>
> So, it's either that, or I'm missing something else!
>
> ----- Original Message -----
> From: "John Lobert" <johnlobert@...
> <mailto:johnlobert%40sbcglobal.net> <mailto:johnlobert%40sbcglobal.net> >
> To: <CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>
> <mailto:CipherChallenge%40yahoogroups.com> >
> Sent: Thursday, June 14, 2007 8:18 PM
> Subject: Re: [CipherChallenge] Genome Cipher?
>
>> Alexandra,
>>
>> Does it have to be anything more than it appears to be, DNA bases?
>>
>> John
>>
>> Alexandra Fiona Dixon <alexandra@...
>> <mailto:alexandra%40t-hunts.com> <mailto:alexandra%40t-hunts.com> >
>> wrote:
>> Hey everybody, long time, no key.
>>
>> So, I was looking at the web site of a company called 23andme.com.
>> This page http://www.23andme.com/jobs.html
>> <http://www.23andme.com/jobs.html> <http://www.23andme.com/jobs.html
>> <http://www.23andme.com/jobs.html> > gives a hint that you
>> should look at the source code.
>>
>> This company is owned by Anne Wojcicki, who just married Sergey Brin
>> of Google (who played on my treasure hunt team a couple of times a
>> few years ago). He loves puzzles, and in fact they screen potential
>> employees at Google by hiding puzzles and ciphers that they have to
>> find and solve in order to apply. So, I wasn't surprised to see
>> something like this on her web site.
>>
>> I looked at the source code and it looks normal except that the dots
>> that appear at the bottom of the visible page are actually a string
>> of DNA bases, as follows:
>>
>> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
>> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
>> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
>> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
>> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
>> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
>> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
>> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
>> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
>> CAGGAACTTCCACACC
>>
>> I turned this into 3-base codons, and then into the standard letter
>> substitutions that represent each codon, and got a 212 letter string
>> that is basically the same 29 letter string repeating over and over,
>> with a bit left over at the end:
>>
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> ELPHQELPH
>>
>> Thinking it might be either a Caesar shift or a Vigenere, I tried
>> the shift (bubkus) and then tried various keys for Vigenere - DNA,
>> Genome, 23andme, etc. Nothing turned up anything. Those are the
>> only keys I have found, and I haven't looked at Playfair yet.
>>
>> I'm not applying for a job there, I'm just curious about what is
>> hidden on the page - maybe it's not even the ACGT string!
>>
>> Alexandra
>>
>>
>>
>>
>>
>>
>> [Non-text portions of this message have been removed]
>>
>>
>>
>>
>> Yahoo! Groups Links
>>
>>
>>
>>
>
> [Non-text portions of this message have been removed]
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>