Search the web
Sign In
New User? Sign Up
CipherChallenge · To exchange views and discuss the "£10,0
? Already a member? Sign in to Yahoo!

Yahoo! Groups Tips

Did you know...
Want your group to be featured on the Yahoo! Groups website? Add a group photo to Flickr.

Best of Y! Groups

   Check them out and nominate your group.
Having problems with message search? Fill out this form to ensure your group is one of the first to be migrated to the new message search system.

Messages

  Messages Help
Advanced
Genome Cipher?   Message List  
Reply | Forward Message #6378 of 6391 |
Re: [CipherChallenge] Genome Cipher?

Oh, you're right! How did I miss that?

Well, maybe it would be worthwhile to start building codons from the 2nd
position.

Nope, tried that. And third.

----- Original Message -----
From: "Tim Roberts" <t.roberts@...>
To: <CipherChallenge@yahoogroups.com>
Sent: Friday, June 15, 2007 12:24 AM
Subject: RE: [CipherChallenge] Genome Cipher?


>
> Alexandra,
>
> Oh! There are 637 letters, not 636! So surely this just about rules out
> a cipher made up of codons....?
>
> Tim
>
> ________________________________
>
> From: Tim Roberts [mailto:t.roberts@...]
> Sent: Fri 15-Jun-07 4:39 PM
> To: CipherChallenge@yahoogroups.com
> Subject: RE: [CipherChallenge] Genome Cipher?
>
>
>
> Hi Alexandra,
>
> Well, if it is indeed a cipher (has that been established?) it would seem
> to me that your first steps have been sensible and correct, ie
> 1) look at the source
> 2) treat the string therein as ACGT bases
> 3) translate them using the standard alphabet
> but then I think you are trying to apply a Caesar or a Vigenere too early.
> Why? Well, if you had a 212-letter ciphertext, fair enough. But what you
> actually have is a 29-letter CT, repeated 7 times, then 5 letters,
> repeating the last 5 of each line, then 4 letters, repeating the first 4
> of the 5. So surely (well, actually, not surely at all!) the next step is
> to find the reason behind this pattern......
>
> ....of course, I'm often completely wrong about such things... :-) :-)
>
> Tim
>
>
> ________________________________
>
> From: Alexandra Fiona Dixon [mailto:alexandra@...
> <mailto:alexandra%40t-hunts.com> ]
> Sent: Fri 15-Jun-07 1:32 PM
> To: CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>
> Subject: Re: [CipherChallenge] Genome Cipher?
>
> No, it doesn't. But the surface page says to be re-source-ful (source is
> in
> italics)...and it's the only thing that seems at all covert on the page.
> The surface page shows dots, but the source code shows bases.
>
> So, it's either that, or I'm missing something else!
>
> ----- Original Message -----
> From: "John Lobert" <johnlobert@...
> <mailto:johnlobert%40sbcglobal.net> <mailto:johnlobert%40sbcglobal.net> >
> To: <CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>
> <mailto:CipherChallenge%40yahoogroups.com> >
> Sent: Thursday, June 14, 2007 8:18 PM
> Subject: Re: [CipherChallenge] Genome Cipher?
>
>> Alexandra,
>>
>> Does it have to be anything more than it appears to be, DNA bases?
>>
>> John
>>
>> Alexandra Fiona Dixon <alexandra@...
>> <mailto:alexandra%40t-hunts.com> <mailto:alexandra%40t-hunts.com> >
>> wrote:
>> Hey everybody, long time, no key.
>>
>> So, I was looking at the web site of a company called 23andme.com.
>> This page http://www.23andme.com/jobs.html
>> <http://www.23andme.com/jobs.html> <http://www.23andme.com/jobs.html
>> <http://www.23andme.com/jobs.html> > gives a hint that you
>> should look at the source code.
>>
>> This company is owned by Anne Wojcicki, who just married Sergey Brin
>> of Google (who played on my treasure hunt team a couple of times a
>> few years ago). He loves puzzles, and in fact they screen potential
>> employees at Google by hiding puzzles and ciphers that they have to
>> find and solve in order to apply. So, I wasn't surprised to see
>> something like this on her web site.
>>
>> I looked at the source code and it looks normal except that the dots
>> that appear at the bottom of the visible page are actually a string
>> of DNA bases, as follows:
>>
>> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
>> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
>> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
>> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
>> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
>> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
>> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
>> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
>> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
>> CAGGAACTTCCACACC
>>
>> I turned this into 3-base codons, and then into the standard letter
>> substitutions that represent each codon, and got a 212 letter string
>> that is basically the same 29 letter string repeating over and over,
>> with a bit left over at the end:
>>
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> ELPHQELPH
>>
>> Thinking it might be either a Caesar shift or a Vigenere, I tried
>> the shift (bubkus) and then tried various keys for Vigenere - DNA,
>> Genome, 23andme, etc. Nothing turned up anything. Those are the
>> only keys I have found, and I haven't looked at Playfair yet.
>>
>> I'm not applying for a job there, I'm just curious about what is
>> hidden on the page - maybe it's not even the ACGT string!
>>
>> Alexandra
>>
>>
>>
>>
>>
>>
>> [Non-text portions of this message have been removed]
>>
>>
>>
>>
>> Yahoo! Groups Links
>>
>>
>>
>>
>
> [Non-text portions of this message have been removed]
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>




Fri Jun 15, 2007 7:34 am

alexandrafio...
Offline Offline
Send Email Send Email

Forward
Message #6378 of 6391 |
Expand Messages Author Sort by Date

Hey everybody, long time, no key. So, I was looking at the web site of a company called 23andme.com. This page http://www.23andme.com/jobs.html gives a hint...
Alexandra Fiona Dixon
alexandrafio...
Offline Send Email
Jun 15, 2007
12:40 am

Alexandra, Does it have to be anything more than it appears to be, DNA bases? John Alexandra Fiona Dixon <alexandra@...> wrote:...
John Lobert
keystonejcl
Offline Send Email
Jun 15, 2007
3:19 am

No, it doesn't. But the surface page says to be re-source-ful (source is in italics)...and it's the only thing that seems at all covert on the page. The...
Alexandra Fiona Dixon
alexandrafio...
Offline Send Email
Jun 15, 2007
3:32 am

I agree with you on all that. I'm just asking what leads you to believe that she wanted the reader to do something with the sequence in the source other than...
John Lobert
keystonejcl
Offline Send Email
Jun 15, 2007
3:22 pm

Hi Alexandra, Well, if it is indeed a cipher (has that been established?) it would seem to me that your first steps have been sensible and correct, ie 1) look...
Tim Roberts
tsr21
Offline Send Email
Jun 15, 2007
6:40 am

Alexandra, Oh! There are 637 letters, not 636! So surely this just about rules out a cipher made up of codons....? Tim ________________________________ From:...
Tim Roberts
tsr21
Offline Send Email
Jun 15, 2007
7:24 am

Oh, you're right! How did I miss that? Well, maybe it would be worthwhile to start building codons from the 2nd position. Nope, tried that. And third. ... ...
Alexandra Fiona Dixon
alexandrafio...
Offline Send Email
Jun 15, 2007
7:34 am

I don't know if it helps, but 637 is 7 * 7 * 13 All the best David Cookson www.musicalsolutions.com...
David Cookson
david@...
Send Email
Jun 15, 2007
8:09 am

Nothing other than that it would be somewhat inelegant to just dump a bunch of codons into the source code and leave it at that. Wishful thinking, maybe!? Is...
Alexandra Fiona Dixon
alexandrafio...
Offline Send Email
Jun 15, 2007
5:14 pm

Hi Alexandra, Yes, I think it's far more likely to be a repeating 29-amino acid peptide, or something (I'm trying to sound knowedgable here) rather than a...
Tim Roberts
tsr21
Offline Send Email
Jun 16, 2007
12:38 am

And the answer is: It's DNA from human chromosome 11. Each segment is expanded by two markers with the rest repeating. Sorry, but no secret code... John ... ...
keystonejcl
Offline Send Email
Jun 20, 2007
4:01 pm

Nice work! Dave keystonejcl <johnlobert@...> wrote: And the answer is: It's DNA from human chromosome 11. Each segment is expanded by two markers...
Dave Smith
aca_photon
Offline Send Email
Jun 20, 2007
6:10 pm

Dave: Wish I could take credit for it, but I can't. It was fellow ACA member HONEYBEE who figured it out. The rest of this group should join us! John KEYSTONE ...
John Lobert
keystonejcl
Offline Send Email
Jun 20, 2007
7:58 pm

Hmmm, I googled that sequence of bases and didn't come up with anything. You mean to say, the whole human genome isn't indexed somewhere??? Seriously, how did...
Alexandra Fiona Dixon
alexandrafio...
Offline Send Email
Jun 21, 2007
2:50 am

Don't know how she identified it. I'll ask her. She knew all about 23andme and someone who had registered his DNA there. As for the entire genome, I don't...
John Lobert
keystonejcl
Offline Send Email
Jun 21, 2007
4:37 am

Hi, When bioscientists encounter a sequence, ususally the first thing they do is do a BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) search. The sequence you...
Wolfgang Beyer
wolfib80
Offline Send Email
Jun 21, 2007
7:22 am

The entire genome is small compared to the length the e-mails on this thread will be if everyone keeps copying the entire thread at the end of their messages....
David Cookson
david@...
Send Email
Jun 21, 2007
7:36 am
Advanced

Copyright © 2009 Yahoo! Inc. All rights reserved.
Privacy Policy - Terms of Service - Guidelines - Help