Hi:
I have a cipher from a geocache.
It has all numbers. It's supposed to be a common cipher, but I have not
found a reference to it.
Any one have any ideas.
Here's the cipher text.
000644460000140041440055000022006644000226602200644600266444444444444446
61664002002440064460000002442004460060226600644200244
Thanks
Hi,
Please can someone help me! I am working my way through Elonkas list
of other codes, and I have come across several that when decrypted
reveal a UUencoded ZIP file. Can anyone tell me how I can open these so
I can see what inside them? I can break normal UUencoded TXT files but
when I try to open the ZIP file using WINZIP it wont open. What am I
doing wrong?
Michelle
Hi,
Are you un-UUencoding the data into a file - renaming it to .zip & trying
to open that?
Paul
On 5/15/07, michelle <fred.michelle@...> wrote:
>
> Hi,
> Please can someone help me! I am working my way through Elonkas list
> of other codes, and I have come across several that when decrypted
> reveal a UUencoded ZIP file. Can anyone tell me how I can open these so
> I can see what inside them? I can break normal UUencoded TXT files but
> when I try to open the ZIP file using WINZIP it wont open. What am I
> doing wrong?
>
> Michelle
>
>
>
[Non-text portions of this message have been removed]
Have you tried changing the suffix from zip to txt and trying to open that?
Sent from my Verizon Wireless BlackBerry
-----Original Message-----
From: "Paul Anderson" <paul.t.anderson@...>
Date: Wed, 16 May 2007 15:29:58
To:CipherChallenge@yahoogroups.com
Subject: Re: [CipherChallenge] new code
Hi,
Are you un-UUencoding the data into a file - renaming it to .zip & trying
to open that?
Paul
On 5/15/07, michelle <fred.michelle@: <mailto:fred.michelle%40tiscali.co.uk>
tiscali.co.uk> wrote:
>
> Hi,
> Please can someone help me! I am working my way through Elonkas list
> of other codes, and I have come across several that when decrypted
> reveal a UUencoded ZIP file. Can anyone tell me how I can open these so
> I can see what inside them? I can break normal UUencoded TXT files but
> when I try to open the ZIP file using WINZIP it wont open. What am I
> doing wrong?
>
> Michelle
>
>
>
[Non-text portions of this message have been removed]
Hi,
Thanks for your help, but I must be doing something wrong because I
just cant get anything to work! Here is the link to the code
http://members.aol.com/nov1337/othercodes.htm its the one called
Adrenalines code. There are two ZIP files here. If someone gets a
chance to have a look at it I would be very greatful. There is a
message before the problem bit which gives a 'password' ie you need to
break the binary first which then helps with the second part, which
should help with the third part. I dont want the decrypted answer but I
sure would like a few clues as to how to go about breaking this next
part!!!! Thanks again for your help!!
Michelle
Hello there!
I've just joined this Group, after having recently decided to try
solve again S. Singh's Cipher Challenge... (I know its quite dated now...)
I was blocked at Stage 7 few years ago (at my first attempt), but for
my second run I've finally been able to solve it, using home-made
tools (Excel VBA), dirty methods and a bit of luck...
Thus I'm now trying to solve Stage 8.
I've read many papers concerning the Enigma Cryptanalysis, including
Jim Gillogly paper (amazingly interesting for a novice like me!), and
I've found the corrected source code of Fauzan Mirza's enigma.c
program - I didn't feel able to write an Enigma simulator from scratch.
So my question (at last ! :o) concerns this enigma.c program.
I'm not sure to understand the use of the different initial parameters
used in it:
char notch[6]="QEVJZ";
char rings[3]={ 'A','A','A' };
char pos[3]= { 'A','A','A' };
I guess that pos[] give the current position of rotors, but I'm not
sure to understand the difference between the notch[] and rings[]
variables...
Is notch[] used to detail the notches of rotors, such as "after rotor
1 reaches the Q letter, step rotor 2" ?
If so, what's the use of the rings[] variable?
I'll continue to investigate this point, but any help would be
welcome! Well, if any of you remember this old Challenge! :o)
Regards,
Stéphane
PS : please excuse my poor English / mistakes, as English isn't my
native language...
Which one is used to
Hey everybody, long time, no key.
So, I was looking at the web site of a company called 23andme.com.
This page http://www.23andme.com/jobs.html gives a hint that you
should look at the source code.
This company is owned by Anne Wojcicki, who just married Sergey Brin
of Google (who played on my treasure hunt team a couple of times a
few years ago). He loves puzzles, and in fact they screen potential
employees at Google by hiding puzzles and ciphers that they have to
find and solve in order to apply. So, I wasn't surprised to see
something like this on her web site.
I looked at the source code and it looks normal except that the dots
that appear at the bottom of the visible page are actually a string
of DNA bases, as follows:
AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
CAGGAACTTCCACACC
I turned this into 3-base codons, and then into the standard letter
substitutions that represent each codon, and got a 212 letter string
that is basically the same 29 letter string repeating over and over,
with a bit left over at the end:
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
ELPHQELPH
Thinking it might be either a Caesar shift or a Vigenere, I tried
the shift (bubkus) and then tried various keys for Vigenere - DNA,
Genome, 23andme, etc. Nothing turned up anything. Those are the
only keys I have found, and I haven't looked at Playfair yet.
I'm not applying for a job there, I'm just curious about what is
hidden on the page - maybe it's not even the ACGT string!
Alexandra
Alexandra,
Does it have to be anything more than it appears to be, DNA bases?
John
Alexandra Fiona Dixon <alexandra@...> wrote:
Hey everybody, long time, no key.
So, I was looking at the web site of a company called 23andme.com.
This page http://www.23andme.com/jobs.html gives a hint that you
should look at the source code.
This company is owned by Anne Wojcicki, who just married Sergey Brin
of Google (who played on my treasure hunt team a couple of times a
few years ago). He loves puzzles, and in fact they screen potential
employees at Google by hiding puzzles and ciphers that they have to
find and solve in order to apply. So, I wasn't surprised to see
something like this on her web site.
I looked at the source code and it looks normal except that the dots
that appear at the bottom of the visible page are actually a string
of DNA bases, as follows:
AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
CAGGAACTTCCACACC
I turned this into 3-base codons, and then into the standard letter
substitutions that represent each codon, and got a 212 letter string
that is basically the same 29 letter string repeating over and over,
with a bit left over at the end:
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
NLSQGRLASVVPEEDSTVPQRQRAELPHQ
ELPHQELPH
Thinking it might be either a Caesar shift or a Vigenere, I tried
the shift (bubkus) and then tried various keys for Vigenere - DNA,
Genome, 23andme, etc. Nothing turned up anything. Those are the
only keys I have found, and I haven't looked at Playfair yet.
I'm not applying for a job there, I'm just curious about what is
hidden on the page - maybe it's not even the ACGT string!
Alexandra
[Non-text portions of this message have been removed]
Does anyone in this group have any knowledge whatsoever (!) regarding the cipher
published by Sir John Herschel in a January 1866 issue of Photographic News,
immediately following his article on chromo-photography?
I have been unable to find even a single reference to it on the web.
Tim
[Non-text portions of this message have been removed]
No, it doesn't. But the surface page says to be re-source-ful (source is in
italics)...and it's the only thing that seems at all covert on the page.
The surface page shows dots, but the source code shows bases.
So, it's either that, or I'm missing something else!
----- Original Message -----
From: "John Lobert" <johnlobert@...>
To: <CipherChallenge@yahoogroups.com>
Sent: Thursday, June 14, 2007 8:18 PM
Subject: Re: [CipherChallenge] Genome Cipher?
> Alexandra,
>
> Does it have to be anything more than it appears to be, DNA bases?
>
> John
>
> Alexandra Fiona Dixon <alexandra@...> wrote:
> Hey everybody, long time, no key.
>
> So, I was looking at the web site of a company called 23andme.com.
> This page http://www.23andme.com/jobs.html gives a hint that you
> should look at the source code.
>
> This company is owned by Anne Wojcicki, who just married Sergey Brin
> of Google (who played on my treasure hunt team a couple of times a
> few years ago). He loves puzzles, and in fact they screen potential
> employees at Google by hiding puzzles and ciphers that they have to
> find and solve in order to apply. So, I wasn't surprised to see
> something like this on her web site.
>
> I looked at the source code and it looks normal except that the dots
> that appear at the bottom of the visible page are actually a string
> of DNA bases, as follows:
>
> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
> CAGGAACTTCCACACC
>
> I turned this into 3-base codons, and then into the standard letter
> substitutions that represent each codon, and got a 212 letter string
> that is basically the same 29 letter string repeating over and over,
> with a bit left over at the end:
>
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> ELPHQELPH
>
> Thinking it might be either a Caesar shift or a Vigenere, I tried
> the shift (bubkus) and then tried various keys for Vigenere - DNA,
> Genome, 23andme, etc. Nothing turned up anything. Those are the
> only keys I have found, and I haven't looked at Playfair yet.
>
> I'm not applying for a job there, I'm just curious about what is
> hidden on the page - maybe it's not even the ACGT string!
>
> Alexandra
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>
Hi Alexandra,
Well, if it is indeed a cipher (has that been established?) it would seem to me
that your first steps have been sensible and correct, ie
1) look at the source
2) treat the string therein as ACGT bases
3) translate them using the standard alphabet
but then I think you are trying to apply a Caesar or a Vigenere too early. Why?
Well, if you had a 212-letter ciphertext, fair enough. But what you actually
have is a 29-letter CT, repeated 7 times, then 5 letters, repeating the last 5
of each line, then 4 letters, repeating the first 4 of the 5. So surely (well,
actually, not surely at all!) the next step is to find the reason behind this
pattern......
....of course, I'm often completely wrong about such things... :-) :-)
Tim
________________________________
From: Alexandra Fiona Dixon [mailto:alexandra@...]
Sent: Fri 15-Jun-07 1:32 PM
To: CipherChallenge@yahoogroups.com
Subject: Re: [CipherChallenge] Genome Cipher?
No, it doesn't. But the surface page says to be re-source-ful (source is in
italics)...and it's the only thing that seems at all covert on the page.
The surface page shows dots, but the source code shows bases.
So, it's either that, or I'm missing something else!
----- Original Message -----
From: "John Lobert" <johnlobert@...
<mailto:johnlobert%40sbcglobal.net> >
To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%40yahoogroups.com>
>
Sent: Thursday, June 14, 2007 8:18 PM
Subject: Re: [CipherChallenge] Genome Cipher?
> Alexandra,
>
> Does it have to be anything more than it appears to be, DNA bases?
>
> John
>
> Alexandra Fiona Dixon <alexandra@... <mailto:alexandra%40t-hunts.com>
> wrote:
> Hey everybody, long time, no key.
>
> So, I was looking at the web site of a company called 23andme.com.
> This page http://www.23andme.com/jobs.html <http://www.23andme.com/jobs.html>
gives a hint that you
> should look at the source code.
>
> This company is owned by Anne Wojcicki, who just married Sergey Brin
> of Google (who played on my treasure hunt team a couple of times a
> few years ago). He loves puzzles, and in fact they screen potential
> employees at Google by hiding puzzles and ciphers that they have to
> find and solve in order to apply. So, I wasn't surprised to see
> something like this on her web site.
>
> I looked at the source code and it looks normal except that the dots
> that appear at the bottom of the visible page are actually a string
> of DNA bases, as follows:
>
> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
> CAGGAACTTCCACACC
>
> I turned this into 3-base codons, and then into the standard letter
> substitutions that represent each codon, and got a 212 letter string
> that is basically the same 29 letter string repeating over and over,
> with a bit left over at the end:
>
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> ELPHQELPH
>
> Thinking it might be either a Caesar shift or a Vigenere, I tried
> the shift (bubkus) and then tried various keys for Vigenere - DNA,
> Genome, 23andme, etc. Nothing turned up anything. Those are the
> only keys I have found, and I haven't looked at Playfair yet.
>
> I'm not applying for a job there, I'm just curious about what is
> hidden on the page - maybe it's not even the ACGT string!
>
> Alexandra
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>
[Non-text portions of this message have been removed]
Alexandra,
Oh! There are 637 letters, not 636! So surely this just about rules out a
cipher made up of codons....?
Tim
________________________________
From: Tim Roberts [mailto:t.roberts@...]
Sent: Fri 15-Jun-07 4:39 PM
To: CipherChallenge@yahoogroups.com
Subject: RE: [CipherChallenge] Genome Cipher?
Hi Alexandra,
Well, if it is indeed a cipher (has that been established?) it would seem to me
that your first steps have been sensible and correct, ie
1) look at the source
2) treat the string therein as ACGT bases
3) translate them using the standard alphabet
but then I think you are trying to apply a Caesar or a Vigenere too early. Why?
Well, if you had a 212-letter ciphertext, fair enough. But what you actually
have is a 29-letter CT, repeated 7 times, then 5 letters, repeating the last 5
of each line, then 4 letters, repeating the first 4 of the 5. So surely (well,
actually, not surely at all!) the next step is to find the reason behind this
pattern......
....of course, I'm often completely wrong about such things... :-) :-)
Tim
________________________________
From: Alexandra Fiona Dixon [mailto:alexandra@...
<mailto:alexandra%40t-hunts.com> ]
Sent: Fri 15-Jun-07 1:32 PM
To: CipherChallenge@yahoogroups.com <mailto:CipherChallenge%40yahoogroups.com>
Subject: Re: [CipherChallenge] Genome Cipher?
No, it doesn't. But the surface page says to be re-source-ful (source is in
italics)...and it's the only thing that seems at all covert on the page.
The surface page shows dots, but the source code shows bases.
So, it's either that, or I'm missing something else!
----- Original Message -----
From: "John Lobert" <johnlobert@...
<mailto:johnlobert%40sbcglobal.net> <mailto:johnlobert%40sbcglobal.net> >
To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%40yahoogroups.com>
<mailto:CipherChallenge%40yahoogroups.com> >
Sent: Thursday, June 14, 2007 8:18 PM
Subject: Re: [CipherChallenge] Genome Cipher?
> Alexandra,
>
> Does it have to be anything more than it appears to be, DNA bases?
>
> John
>
> Alexandra Fiona Dixon <alexandra@... <mailto:alexandra%40t-hunts.com>
<mailto:alexandra%40t-hunts.com> > wrote:
> Hey everybody, long time, no key.
>
> So, I was looking at the web site of a company called 23andme.com.
> This page http://www.23andme.com/jobs.html <http://www.23andme.com/jobs.html>
<http://www.23andme.com/jobs.html <http://www.23andme.com/jobs.html> > gives a
hint that you
> should look at the source code.
>
> This company is owned by Anne Wojcicki, who just married Sergey Brin
> of Google (who played on my treasure hunt team a couple of times a
> few years ago). He loves puzzles, and in fact they screen potential
> employees at Google by hiding puzzles and ciphers that they have to
> find and solve in order to apply. So, I wasn't surprised to see
> something like this on her web site.
>
> I looked at the source code and it looks normal except that the dots
> that appear at the bottom of the visible page are actually a string
> of DNA bases, as follows:
>
> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
> CAGGAACTTCCACACC
>
> I turned this into 3-base codons, and then into the standard letter
> substitutions that represent each codon, and got a 212 letter string
> that is basically the same 29 letter string repeating over and over,
> with a bit left over at the end:
>
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> ELPHQELPH
>
> Thinking it might be either a Caesar shift or a Vigenere, I tried
> the shift (bubkus) and then tried various keys for Vigenere - DNA,
> Genome, 23andme, etc. Nothing turned up anything. Those are the
> only keys I have found, and I haven't looked at Playfair yet.
>
> I'm not applying for a job there, I'm just curious about what is
> hidden on the page - maybe it's not even the ACGT string!
>
> Alexandra
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>
[Non-text portions of this message have been removed]
[Non-text portions of this message have been removed]
Oh, you're right! How did I miss that?
Well, maybe it would be worthwhile to start building codons from the 2nd
position.
Nope, tried that. And third.
----- Original Message -----
From: "Tim Roberts" <t.roberts@...>
To: <CipherChallenge@yahoogroups.com>
Sent: Friday, June 15, 2007 12:24 AM
Subject: RE: [CipherChallenge] Genome Cipher?
>
> Alexandra,
>
> Oh! There are 637 letters, not 636! So surely this just about rules out
> a cipher made up of codons....?
>
> Tim
>
> ________________________________
>
> From: Tim Roberts [mailto:t.roberts@...]
> Sent: Fri 15-Jun-07 4:39 PM
> To: CipherChallenge@yahoogroups.com
> Subject: RE: [CipherChallenge] Genome Cipher?
>
>
>
> Hi Alexandra,
>
> Well, if it is indeed a cipher (has that been established?) it would seem
> to me that your first steps have been sensible and correct, ie
> 1) look at the source
> 2) treat the string therein as ACGT bases
> 3) translate them using the standard alphabet
> but then I think you are trying to apply a Caesar or a Vigenere too early.
> Why? Well, if you had a 212-letter ciphertext, fair enough. But what you
> actually have is a 29-letter CT, repeated 7 times, then 5 letters,
> repeating the last 5 of each line, then 4 letters, repeating the first 4
> of the 5. So surely (well, actually, not surely at all!) the next step is
> to find the reason behind this pattern......
>
> ....of course, I'm often completely wrong about such things... :-) :-)
>
> Tim
>
>
> ________________________________
>
> From: Alexandra Fiona Dixon [mailto:alexandra@...
> <mailto:alexandra%40t-hunts.com> ]
> Sent: Fri 15-Jun-07 1:32 PM
> To: CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>
> Subject: Re: [CipherChallenge] Genome Cipher?
>
> No, it doesn't. But the surface page says to be re-source-ful (source is
> in
> italics)...and it's the only thing that seems at all covert on the page.
> The surface page shows dots, but the source code shows bases.
>
> So, it's either that, or I'm missing something else!
>
> ----- Original Message -----
> From: "John Lobert" <johnlobert@...
> <mailto:johnlobert%40sbcglobal.net> <mailto:johnlobert%40sbcglobal.net> >
> To: <CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>
> <mailto:CipherChallenge%40yahoogroups.com> >
> Sent: Thursday, June 14, 2007 8:18 PM
> Subject: Re: [CipherChallenge] Genome Cipher?
>
>> Alexandra,
>>
>> Does it have to be anything more than it appears to be, DNA bases?
>>
>> John
>>
>> Alexandra Fiona Dixon <alexandra@...
>> <mailto:alexandra%40t-hunts.com> <mailto:alexandra%40t-hunts.com> >
>> wrote:
>> Hey everybody, long time, no key.
>>
>> So, I was looking at the web site of a company called 23andme.com.
>> This page http://www.23andme.com/jobs.html
>> <http://www.23andme.com/jobs.html> <http://www.23andme.com/jobs.html
>> <http://www.23andme.com/jobs.html> > gives a hint that you
>> should look at the source code.
>>
>> This company is owned by Anne Wojcicki, who just married Sergey Brin
>> of Google (who played on my treasure hunt team a couple of times a
>> few years ago). He loves puzzles, and in fact they screen potential
>> employees at Google by hiding puzzles and ciphers that they have to
>> find and solve in order to apply. So, I wasn't surprised to see
>> something like this on her web site.
>>
>> I looked at the source code and it looks normal except that the dots
>> that appear at the bottom of the visible page are actually a string
>> of DNA bases, as follows:
>>
>> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
>> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
>> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
>> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
>> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
>> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
>> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
>> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
>> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
>> CAGGAACTTCCACACC
>>
>> I turned this into 3-base codons, and then into the standard letter
>> substitutions that represent each codon, and got a 212 letter string
>> that is basically the same 29 letter string repeating over and over,
>> with a bit left over at the end:
>>
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
>> ELPHQELPH
>>
>> Thinking it might be either a Caesar shift or a Vigenere, I tried
>> the shift (bubkus) and then tried various keys for Vigenere - DNA,
>> Genome, 23andme, etc. Nothing turned up anything. Those are the
>> only keys I have found, and I haven't looked at Playfair yet.
>>
>> I'm not applying for a job there, I'm just curious about what is
>> hidden on the page - maybe it's not even the ACGT string!
>>
>> Alexandra
>>
>>
>>
>>
>>
>>
>> [Non-text portions of this message have been removed]
>>
>>
>>
>>
>> Yahoo! Groups Links
>>
>>
>>
>>
>
> [Non-text portions of this message have been removed]
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>
I agree with you on all that. I'm just asking what leads you to believe that she
wanted the reader to do something with the sequence in the source other than
discovering it?
John
Alexandra Fiona Dixon <alexandra@...> wrote:
No, it doesn't. But the surface page says to be re-source-ful (source
is in
italics)...and it's the only thing that seems at all covert on the page.
The surface page shows dots, but the source code shows bases.
So, it's either that, or I'm missing something else!
----- Original Message -----
From: "John Lobert" <johnlobert@...>
To: <CipherChallenge@yahoogroups.com>
Sent: Thursday, June 14, 2007 8:18 PM
Subject: Re: [CipherChallenge] Genome Cipher?
> Alexandra,
>
> Does it have to be anything more than it appears to be, DNA bases?
>
> John
>
> Alexandra Fiona Dixon <alexandra@...> wrote:
> Hey everybody, long time, no key.
>
> So, I was looking at the web site of a company called 23andme.com.
> This page http://www.23andme.com/jobs.html gives a hint that you
> should look at the source code.
>
> This company is owned by Anne Wojcicki, who just married Sergey Brin
> of Google (who played on my treasure hunt team a couple of times a
> few years ago). He loves puzzles, and in fact they screen potential
> employees at Google by hiding puzzles and ciphers that they have to
> find and solve in order to apply. So, I wasn't surprised to see
> something like this on her web site.
>
> I looked at the source code and it looks normal except that the dots
> that appear at the bottom of the visible page are actually a string
> of DNA bases, as follows:
>
> AACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGT
> GCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACC
> GTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTG
> CCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGA
> AGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACAC
> CAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAA
> CGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTGGTGCCAGAGGAAGACAGC
> ACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGAACCTCAGCCAAGGAAGGCTTGCTTCTGTG
> GTGCCAGAGGAAGACAGCACCGTACCGCAACGTCAACGTGCAGAACTTCCACACCAGGAACTTCCACAC
> CAGGAACTTCCACACC
>
> I turned this into 3-base codons, and then into the standard letter
> substitutions that represent each codon, and got a 212 letter string
> that is basically the same 29 letter string repeating over and over,
> with a bit left over at the end:
>
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> NLSQGRLASVVPEEDSTVPQRQRAELPHQ
> ELPHQELPH
>
> Thinking it might be either a Caesar shift or a Vigenere, I tried
> the shift (bubkus) and then tried various keys for Vigenere - DNA,
> Genome, 23andme, etc. Nothing turned up anything. Those are the
> only keys I have found, and I haven't looked at Playfair yet.
>
> I'm not applying for a job there, I'm just curious about what is
> hidden on the page - maybe it's not even the ACGT string!
>
> Alexandra
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>
[Non-text portions of this message have been removed]
Nothing other than that it would be somewhat inelegant to just dump a bunch
of codons into the source code and leave it at that. Wishful thinking,
maybe!?
Is the sequence long enough to actually code for a protein? Maybe job
applicants are supposed to name the protein...
A'a
----- Original Message -----
From: "John Lobert" <johnlobert@...>
To: <CipherChallenge@yahoogroups.com>
Sent: Friday, June 15, 2007 8:20 AM
Subject: Re: [CipherChallenge] Genome Cipher?
>I agree with you on all that. I'm just asking what leads you to believe
>that she wanted the reader to do something with the sequence in the source
>other than discovering it?
>
> John
Hi Alexandra,
Yes, I think it's far more likely to be a repeating 29-amino acid peptide, or
something (I'm trying to sound knowedgable here) rather than a cipher.....
Tim
________________________________
From: Alexandra Fiona Dixon [mailto:alexandra@...]
Sent: Sat 16-Jun-07 3:13 AM
To: CipherChallenge@yahoogroups.com
Subject: Re: [CipherChallenge] Genome Cipher?
Nothing other than that it would be somewhat inelegant to just dump a bunch
of codons into the source code and leave it at that. Wishful thinking,
maybe!?
Is the sequence long enough to actually code for a protein? Maybe job
applicants are supposed to name the protein...
A'a
----- Original Message -----
From: "John Lobert" <johnlobert@...
<mailto:johnlobert%40sbcglobal.net> >
To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%40yahoogroups.com>
>
Sent: Friday, June 15, 2007 8:20 AM
Subject: Re: [CipherChallenge] Genome Cipher?
>I agree with you on all that. I'm just asking what leads you to believe
>that she wanted the reader to do something with the sequence in the source
>other than discovering it?
>
> John
[Non-text portions of this message have been removed]
And the answer is:
It's DNA from human chromosome 11. Each segment is expanded by two
markers with the rest repeating. Sorry, but no secret code...
John
--- In CipherChallenge@yahoogroups.com, "Tim Roberts"
<t.roberts@...> wrote:
>
> Hi Alexandra,
>
> Yes, I think it's far more likely to be a repeating 29-amino acid
peptide, or something (I'm trying to sound knowedgable here) rather
than a cipher.....
>
> Tim
>
>
> ________________________________
>
> From: Alexandra Fiona Dixon [mailto:alexandra@...]
> Sent: Sat 16-Jun-07 3:13 AM
> To: CipherChallenge@yahoogroups.com
> Subject: Re: [CipherChallenge] Genome Cipher?
>
>
>
> Nothing other than that it would be somewhat inelegant to just
dump a bunch
> of codons into the source code and leave it at that. Wishful
thinking,
> maybe!?
>
> Is the sequence long enough to actually code for a protein? Maybe
job
> applicants are supposed to name the protein...
>
> A'a
>
> ----- Original Message -----
> From: "John Lobert" <johnlobert@... <mailto:johnlobert%
40sbcglobal.net> >
> To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%
40yahoogroups.com> >
> Sent: Friday, June 15, 2007 8:20 AM
> Subject: Re: [CipherChallenge] Genome Cipher?
>
> >I agree with you on all that. I'm just asking what leads you to
believe
> >that she wanted the reader to do something with the sequence in
the source
> >other than discovering it?
> >
> > John
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
Nice work!
Dave
keystonejcl <johnlobert@...> wrote:
And the answer is:
It's DNA from human chromosome 11. Each segment is expanded by two
markers with the rest repeating. Sorry, but no secret code...
John
--- In CipherChallenge@yahoogroups.com, "Tim Roberts"
<t.roberts@...> wrote:
>
> Hi Alexandra,
>
> Yes, I think it's far more likely to be a repeating 29-amino acid
peptide, or something (I'm trying to sound knowedgable here) rather
than a cipher.....
>
> Tim
>
>
> ________________________________
>
> From: Alexandra Fiona Dixon [mailto:alexandra@...]
> Sent: Sat 16-Jun-07 3:13 AM
> To: CipherChallenge@yahoogroups.com
> Subject: Re: [CipherChallenge] Genome Cipher?
>
>
>
> Nothing other than that it would be somewhat inelegant to just
dump a bunch
> of codons into the source code and leave it at that. Wishful
thinking,
> maybe!?
>
> Is the sequence long enough to actually code for a protein? Maybe
job
> applicants are supposed to name the protein...
>
> A'a
>
> ----- Original Message -----
> From: "John Lobert" <johnlobert@... <mailto:johnlobert%
40sbcglobal.net> >
> To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%
40yahoogroups.com> >
> Sent: Friday, June 15, 2007 8:20 AM
> Subject: Re: [CipherChallenge] Genome Cipher?
>
> >I agree with you on all that. I'm just asking what leads you to
believe
> >that she wanted the reader to do something with the sequence in
the source
> >other than discovering it?
> >
> > John
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
---------------------------------
You snooze, you lose. Get messages ASAP with AutoCheck
in the all-new Yahoo! Mail Beta.
[Non-text portions of this message have been removed]
Dave:
Wish I could take credit for it, but I can't. It was fellow ACA member
HONEYBEE who figured it out. The rest of this group should join us!
John
KEYSTONE
Dave Smith <aca_photon@...> wrote:
Nice work!
Dave
keystonejcl <johnlobert@...> wrote:
And the answer is:
It's DNA from human chromosome 11. Each segment is expanded by two
markers with the rest repeating. Sorry, but no secret code...
John
--- In CipherChallenge@yahoogroups.com, "Tim Roberts"
<t.roberts@...> wrote:
>
> Hi Alexandra,
>
> Yes, I think it's far more likely to be a repeating 29-amino acid
peptide, or something (I'm trying to sound knowedgable here) rather
than a cipher.....
>
> Tim
>
>
> ________________________________
>
> From: Alexandra Fiona Dixon [mailto:alexandra@...]
> Sent: Sat 16-Jun-07 3:13 AM
> To: CipherChallenge@yahoogroups.com
> Subject: Re: [CipherChallenge] Genome Cipher?
>
>
>
> Nothing other than that it would be somewhat inelegant to just
dump a bunch
> of codons into the source code and leave it at that. Wishful
thinking,
> maybe!?
>
> Is the sequence long enough to actually code for a protein? Maybe
job
> applicants are supposed to name the protein...
>
> A'a
>
> ----- Original Message -----
> From: "John Lobert" <johnlobert@... <mailto:johnlobert%
40sbcglobal.net> >
> To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%
40yahoogroups.com> >
> Sent: Friday, June 15, 2007 8:20 AM
> Subject: Re: [CipherChallenge] Genome Cipher?
>
> >I agree with you on all that. I'm just asking what leads you to
believe
> >that she wanted the reader to do something with the sequence in
the source
> >other than discovering it?
> >
> > John
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
---------------------------------
You snooze, you lose. Get messages ASAP with AutoCheck
in the all-new Yahoo! Mail Beta.
[Non-text portions of this message have been removed]
[Non-text portions of this message have been removed]
Hmmm, I googled that sequence of bases and didn't come up with anything.
You mean to say, the whole human genome isn't indexed somewhere???
Seriously, how did Honeybee identify that sequence?
----- Original Message -----
From: "John Lobert" <johnlobert@...>
To: <CipherChallenge@yahoogroups.com>
Sent: Wednesday, June 20, 2007 12:58 PM
Subject: Re: [CipherChallenge] Re: Genome Cipher?
> Dave:
>
> Wish I could take credit for it, but I can't. It was fellow ACA member
> HONEYBEE who figured it out. The rest of this group should join us!
>
> John
> KEYSTONE
>
> Dave Smith <aca_photon@...> wrote:
> Nice work!
>
> Dave
>
> keystonejcl <johnlobert@...> wrote:
> And the answer is:
>
> It's DNA from human chromosome 11. Each segment is expanded by two
> markers with the rest repeating. Sorry, but no secret code...
>
> John
>
> --- In CipherChallenge@yahoogroups.com, "Tim Roberts"
> <t.roberts@...> wrote:
>>
>> Hi Alexandra,
>>
>> Yes, I think it's far more likely to be a repeating 29-amino acid
> peptide, or something (I'm trying to sound knowedgable here) rather
> than a cipher.....
>>
>> Tim
>>
>>
>> ________________________________
>>
>> From: Alexandra Fiona Dixon [mailto:alexandra@...]
>> Sent: Sat 16-Jun-07 3:13 AM
>> To: CipherChallenge@yahoogroups.com
>> Subject: Re: [CipherChallenge] Genome Cipher?
>>
>>
>>
>> Nothing other than that it would be somewhat inelegant to just
> dump a bunch
>> of codons into the source code and leave it at that. Wishful
> thinking,
>> maybe!?
>>
>> Is the sequence long enough to actually code for a protein? Maybe
> job
>> applicants are supposed to name the protein...
>>
>> A'a
>>
>> ----- Original Message -----
>> From: "John Lobert" <johnlobert@... <mailto:johnlobert%
> 40sbcglobal.net> >
>> To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%
> 40yahoogroups.com> >
>> Sent: Friday, June 15, 2007 8:20 AM
>> Subject: Re: [CipherChallenge] Genome Cipher?
>>
>> >I agree with you on all that. I'm just asking what leads you to
> believe
>> >that she wanted the reader to do something with the sequence in
> the source
>> >other than discovering it?
>> >
>> > John
>>
>>
>>
>>
>>
>>
>> [Non-text portions of this message have been removed]
>>
>
> ---------------------------------
> You snooze, you lose. Get messages ASAP with AutoCheck
> in the all-new Yahoo! Mail Beta.
>
> [Non-text portions of this message have been removed]
>
>
>
>
>
>
> [Non-text portions of this message have been removed]
>
>
>
>
> Yahoo! Groups Links
>
>
>
>
Don't know how she identified it. I'll ask her. She knew all about 23andme and
someone who had
registered his DNA there.
As for the entire genome, I don't think so. With 3.2 billion base pairs, I doubt
anyone would go
to the trouble.
John
--- Alexandra Fiona Dixon <alexandra@...> wrote:
> Hmmm, I googled that sequence of bases and didn't come up with anything.
> You mean to say, the whole human genome isn't indexed somewhere???
>
> Seriously, how did Honeybee identify that sequence?
>
>
> ----- Original Message -----
> From: "John Lobert" <johnlobert@...>
> To: <CipherChallenge@yahoogroups.com>
> Sent: Wednesday, June 20, 2007 12:58 PM
> Subject: Re: [CipherChallenge] Re: Genome Cipher?
>
>
> > Dave:
> >
> > Wish I could take credit for it, but I can't. It was fellow ACA member
> > HONEYBEE who figured it out. The rest of this group should join us!
> >
> > John
> > KEYSTONE
> >
> > Dave Smith <aca_photon@...> wrote:
> > Nice work!
> >
> > Dave
> >
> > keystonejcl <johnlobert@...> wrote:
> > And the answer is:
> >
> > It's DNA from human chromosome 11. Each segment is expanded by two
> > markers with the rest repeating. Sorry, but no secret code...
> >
> > John
> >
> > --- In CipherChallenge@yahoogroups.com, "Tim Roberts"
> > <t.roberts@...> wrote:
> >>
> >> Hi Alexandra,
> >>
> >> Yes, I think it's far more likely to be a repeating 29-amino acid
> > peptide, or something (I'm trying to sound knowedgable here) rather
> > than a cipher.....
> >>
> >> Tim
> >>
> >>
> >> ________________________________
> >>
> >> From: Alexandra Fiona Dixon [mailto:alexandra@...]
> >> Sent: Sat 16-Jun-07 3:13 AM
> >> To: CipherChallenge@yahoogroups.com
> >> Subject: Re: [CipherChallenge] Genome Cipher?
> >>
> >>
> >>
> >> Nothing other than that it would be somewhat inelegant to just
> > dump a bunch
> >> of codons into the source code and leave it at that. Wishful
> > thinking,
> >> maybe!?
> >>
> >> Is the sequence long enough to actually code for a protein? Maybe
> > job
> >> applicants are supposed to name the protein...
> >>
> >> A'a
> >>
> >> ----- Original Message -----
> >> From: "John Lobert" <johnlobert@... <mailto:johnlobert%
> > 40sbcglobal.net> >
> >> To: <CipherChallenge@yahoogroups.com <mailto:CipherChallenge%
> > 40yahoogroups.com> >
> >> Sent: Friday, June 15, 2007 8:20 AM
> >> Subject: Re: [CipherChallenge] Genome Cipher?
> >>
> >> >I agree with you on all that. I'm just asking what leads you to
> > believe
> >> >that she wanted the reader to do something with the sequence in
> > the source
> >> >other than discovering it?
> >> >
> >> > John
> >>
> >>
> >>
> >>
> >>
> >>
> >> [Non-text portions of this message have been removed]
> >>
> >
> > ---------------------------------
> > You snooze, you lose. Get messages ASAP with AutoCheck
> > in the all-new Yahoo! Mail Beta.
> >
> > [Non-text portions of this message have been removed]
> >
> >
> >
> >
> >
> >
> > [Non-text portions of this message have been removed]
> >
> >
> >
> >
> > Yahoo! Groups Links
> >
> >
> >
> >
>
>
Hi,
When bioscientists encounter a sequence, ususally the first thing they
do is do a BLAST (http://www.ncbi.nlm.nih.gov/BLAST/) search. The
sequence you posted gives a nice hit at human chromosome 11.
Regards,
Wolfgang
John Lobert schrieb:
>
>
> Don't know how she identified it. I'll ask her. She knew all about
> 23andme and someone who had
> registered his DNA there.
>
> As for the entire genome, I don't think so. With 3.2 billion base pairs,
> I doubt anyone would go
> to the trouble.
>
> John
>
> --- Alexandra Fiona Dixon <alexandra@...
> <mailto:alexandra%40t-hunts.com>> wrote:
>
> > Hmmm, I googled that sequence of bases and didn't come up with anything.
> > You mean to say, the whole human genome isn't indexed somewhere???
> >
> > Seriously, how did Honeybee identify that sequence?
> >
> >
> > ----- Original Message -----
> > From: "John Lobert" <johnlobert@...
> <mailto:johnlobert%40sbcglobal.net>>
> > To: <CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>>
> > Sent: Wednesday, June 20, 2007 12:58 PM
> > Subject: Re: [CipherChallenge] Re: Genome Cipher?
> >
> >
> > > Dave:
> > >
> > > Wish I could take credit for it, but I can't. It was fellow ACA member
> > > HONEYBEE who figured it out. The rest of this group should join us!
> > >
> > > John
> > > KEYSTONE
> > >
> > > Dave Smith <aca_photon@... <mailto:aca_photon%40yahoo.com>>
> wrote:
> > > Nice work!
> > >
> > > Dave
> > >
> > > keystonejcl <johnlobert@...
> <mailto:johnlobert%40sbcglobal.net>> wrote:
> > > And the answer is:
> > >
> > > It's DNA from human chromosome 11. Each segment is expanded by two
> > > markers with the rest repeating. Sorry, but no secret code...
> > >
> > > John
> > >
> > > --- In CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>, "Tim Roberts"
> > > <t.roberts@...> wrote:
> > >>
> > >> Hi Alexandra,
> > >>
> > >> Yes, I think it's far more likely to be a repeating 29-amino acid
> > > peptide, or something (I'm trying to sound knowedgable here) rather
> > > than a cipher.....
> > >>
> > >> Tim
> > >>
> > >>
> > >> ________________________________
> > >>
> > >> From: Alexandra Fiona Dixon [mailto:alexandra@...]
> > >> Sent: Sat 16-Jun-07 3:13 AM
> > >> To: CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com>
> > >> Subject: Re: [CipherChallenge] Genome Cipher?
> > >>
> > >>
> > >>
> > >> Nothing other than that it would be somewhat inelegant to just
> > > dump a bunch
> > >> of codons into the source code and leave it at that. Wishful
> > > thinking,
> > >> maybe!?
> > >>
> > >> Is the sequence long enough to actually code for a protein? Maybe
> > > job
> > >> applicants are supposed to name the protein...
> > >>
> > >> A'a
> > >>
> > >> ----- Original Message -----
> > >> From: "John Lobert" <johnlobert@... <mailto:johnlobert%
> > > 40sbcglobal.net> >
> > >> To: <CipherChallenge@yahoogroups.com
> <mailto:CipherChallenge%40yahoogroups.com> <mailto:CipherChallenge%
> > > 40yahoogroups.com> >
> > >> Sent: Friday, June 15, 2007 8:20 AM
> > >> Subject: Re: [CipherChallenge] Genome Cipher?
> > >>
> > >> >I agree with you on all that. I'm just asking what leads you to
> > > believe
> > >> >that she wanted the reader to do something with the sequence in
> > > the source
> > >> >other than discovering it?
> > >> >
> > >> > John
> > >>
> > >>
> > >>
> > >>
> > >>
> > >>
> > >> [Non-text portions of this message have been removed]
> > >>
> > >
> > > ---------------------------------
> > > You snooze, you lose. Get messages ASAP with AutoCheck
> > > in the all-new Yahoo! Mail Beta.
> > >
> > > [Non-text portions of this message have been removed]
> > >
> > >
> > >
> > >
> > >
> > >
> > > [Non-text portions of this message have been removed]
> > >
> > >
> > >
> > >
> > > Yahoo! Groups Links
> > >
> > >
> > >
> > >
> >
> >
>
>
The entire genome is small compared to the length the e-mails on this
thread will be if everyone keeps copying the entire thread at the end of
their messages. <grin>
David Cookson
www.musicalsolutions.com
At 05:36 21/06/2007, John Lobert wrote:<<As for the entire genome, I don't
think so. With 3.2 billion base pairs, I doubt anyone would go to the
trouble.>>
Just wanted to mention a new site. www.TreasureQuestSociety.com
<http://www.TreasureQuestSociety.com>
They are hosting a Clue solving competition. You can win half of all the
entry fees! It's codes, riddles, anagrams etc. but I thought many of you
have a good shot at it! looks fun anyway.
I'm posting the first clue you get before the competition starts
(May15th) You can pre-register and download all 10 clues on the start
day- see the site.
A treasure of great wealth is yours to keep, if you are the first to
complete. A Treasure Hunt Competition is now underway. Below is the key
if you want to play. To solve the puzzle takes both heart and skill, so
try it now if you have the will.
Vigenere:
ulpojtapfppxssbjvdhymypwoieadeoidgaoxpfjpaecsjrevacmrdnjdp
[Non-text portions of this message have been removed]