agnet-l : Messages : 4125-4154 of 4154

China cultivates record high-yield "super rice"
September 11, 2005
Agence France Presse
BEIJING - The Xinhua news agency was cited as reporting Sunday that Chinese agronomists have cultivated a new species of "super rice" which yields a record high harvest, and that the new species, called Super Rice II YOU 28, has an average per-hectare (2.47 acre) yield of 18,449.55 kilograms (40,589 pounds).
Xinhua cited experts as saying that the new yield broke the record set in 2004 which witnessed per-hectare yield of 18,298.5 kilograms.
The new species of high-yield hybrid rice was sown in March, planted in May and harvested on September 10 at Taoyuan village, Yongsheng county in the southern province of Yunnan.

Russian wheat aphid a threat in southern Alberta; "the aphids are often difficult to find because damaged leaves tend to roll up, hiding the aphids inside."
September 9, 2005
Lloydminster Meridian Booster
A18
Russian wheat aphid (RWA) has, according to this story, been confirmed in the Lethbridge area, and may pose a threat to winter wheat producers this fall. Winged adults have also been confirmed, meaning that the aphids will be capable of migrating from spring wheat fields to newly planted winter wheat fields. Producers need to be checking their fields for this pest.
Scott Meers, integrated crop management specialist with Alberta Agriculture, was quoted as saying, "Russian wheat aphid has not historically over-wintered in Alberta, and has migrated in from the U.S. to establish a population here."
RWA causes damage by injecting toxins into the wheat plant during feeding. This results in purplish looking plants and leaves that have longitudinal yellowish and whitish streaks. Heavily infested tillers tend to lay prostrate on the ground.

Citrus canker - Australia (QLD) (05)
September 11, 2005
A ProMED-mail post
http://www.promedmail.org
ProMED-mail is a program of the International Society for Infectious Diseases
http://www.isid.org
Sponsored in part by Elsevier, publisher of The Clinical Journal of Virology
http://intl.elsevierhealth.com/journals/jocv
Date: 8 Sep 2005
From: ProMED-mail Source: Australian Broadcasting Corp, 7 Sep 2005 [edited]
The outbreak of citrus canker [CC] in central Queensland will claim its 1st non-commercial victims next week. From Monday, Queensland's Department of Primary Industries (DPI) will destroy more than 4000 private backyard trees, 115 000 commercial trees and 2700 hectares of native citrus around Emerald. The DPI's manager of plant health, Chris Adriaansen, is confident the disease has been halted.
"We have been working through all of those issues and engaging with the community," he said. "We have already started working through the Emerald area in doing the assessment process of identifying the size and complexity of taking trees out of backyards, and generally the understanding and the appreciation for what we are trying to do has been good from the Emerald community.
"Obviously where people have got issues we've been addressing those and dealing with them on an individual basis."
[The decision to destroy non-commercial citrus trees is a major departure and it will profoundly affect residential homeowners. There is no option but to destroy citrus trees in private backyards in order to reduce or eliminate CC. The outbreak began almost 12 months ago; the cost so far to growers is about $100 million; and the cost to government is another $13 million.
This review of disease management at the Emerald site is well worth reading: http://www.abc.net.au/landline/content/2005/s1382164.htm - Mod.DH]

Subsidy row taints EU debate on farming, climate change
September 11, 2005
Agence France Presse
Aude Genet
LONDON - EU farm and environment ministers were cited as debating on Sunday the link between agriculture and global warming, at a meeting in London that failed to escape a cross-Channel row over farm subsidies.
The story says that the weekend informal meeting, organised by the British presidency of the European Union, dovetailed with Britain's efforts to put climate change at the top of the international agenda.
Environment Secretary Margaret Beckett, who noted that in Britain, farming was the second-largest source of greenhouse gases, was quoted as saying, "Climate change is the most serious and long-term challenge we face. Farmers can help to address the drastic impacts of climate change, for example through water management to reduce the risks of flooding. The agricultural sector also needs to consider how it can contribute to reducing its own direct emissions of greenhouse gases�for instance, through energy crop production and changing their management practices for fertiliser and manure application."

#4132

From: Doug Powell <dpowell@...>
Date: Mon Sep 12, 2005 2:39 pm
Subject: Agnet Sept. 12/05

dpowell@...

how to subscribe

EU to consider GMO crop-growing laws after April
September 12, 2005
Reuters
Jeremy Smith
LONDON - EU Agriculture Commissioner Mariann Fischer Boel was cited as saying Sunday she will wait until at least next April to decide whether to draft rules to tell farmers how to separate traditional, organic and genetically modified (GMO) crops.
The story explains that so far, the European Commission has said the EU's 25 member states must take responsibility for how their farmers separate the three farming types and minimise cross-contamination: an issue known as coexistence in EU jargon.
Only a handful of governments�around six or seven�have GMO coexistence laws, based on a set of broad non-binding guidelines that the Commission published in July 2003.

Agnet Sept. 12/05

EU to consider GMO crop-growing laws after April

Researchers say University of Manitoba blocked video on GM crops

The golden rice controversy: useless science or unfounded criticism?

Glassy-winged search continues

Computer-aided farming levels off

EU pushes biofuel to fight climate change, high oil

1,3-dichloropropene risk assessment; notice of availability; extension of comment period

Dazomet risk assessment; notice of availability; extension of comment period

Metam sodium risk assessment; notice of availability; extension of Comment period

Researchers say University of Manitoba blocked video on GM crops
September 12, 2005
CP Wire
Helen Fallding
WINNIPEG -- Stephane McLachlan, an environment professor at the University of Manitoba, and his PhD student Ian Mauro, were cited as accusing the university of blocking the release of their video exploring the risks of genetically modified crops while at the same courting funds from biotech companies.
The story explains that the two completed a feature-length documentary in 2002 with help from independent Winnipeg filmmaker Jim Sanders, and is based on interviews with Prairie farmers about their experiences -- good and bad -- with genetically modified canola.
But the Seeds of Change video has never been screened because the university and the researchers, who share the copyright, have been unable to negotiate an agreement on its release.
The story explains that the university originally demanded assurances it would not be liable if anyone sued. One insurer demanded a $50,000 deductible for any lawsuits by crop marketer Monsanto, which has a reputation for protecting its interests vigorously through the courts.
The company is featured in the documentary because of its legal battle with a Saskatchewan farmer and its development of genetically modified wheat.
Monsanto Canada spokeswoman Trish Jordan was quoted as saying, "Obviously, we've never seen (the video), so I'm not sure how these guys could assume that we would sue them."
Now that a private investor has pulled out of the Seeds of Change project and the filmmakers have made it clear they don't intend to make a profit, the lawsuit issue has apparently been dropped by the university.
Alan Simms, who represented the university in early negotiations before going on to head the university's Smartpark research complex, was quoted as saying, "I've seen (the video) and I think it's fair. It's not a biased kind of thing."
But McLachlan said the university is still demanding control over where and when the video is shown, while at the same time requiring a disclaimer indicating the project has nothing to do with the university.
University spokesman John Danakas would not say what restrictions the university would place on how the video is screened, because those details have not yet been discussed with the researchers.
The university wants to make sure the documentary is only used for educational purposes, he said.

The golden rice controversy: useless science or unfounded criticism?
September 12, 2005
Bioscience via Syngenta Media Clipping
Jorge E Mayer
http://www.bioscience.org
Earlier this year, scientists disclosed in the journal Nature Biotechnology the development of a new Golden Rice, a genetically engineered form of the crop capable of producing 23 times more provitamin A (betacarotene) than a prototype announced in the year 2000 (Paine et al. 2005). However, rather than celebrate the potential of this breakthrough to alleviate suffering and reduce the number of deaths caused by malnutrition-in the millions, many of them children in developing countries- Greenpeace greeted the development with claims that Golden Rice is "not effective" and "superfluous" (Greenpeace 2005; see Maxeiner 2005 for a critical response). Organizations like Greenpeace rightly see this advance as threatening their antibiotechnology campaign, which lacks a scientific basis and has relied mainly on the manipulation of people's perceptions.
For several years, a few countries with intensive agriculture have been adopting transgenic crops at a rapid pace. More recently, the technology has also gained significant momentum in developing countries. South Africa's insect-resistant maize and cotton programs have proved very successful and are growing steadily. In India, despite reports of one failure-purely agronomic and not involving any biosafety issues-the adoption and registration of riew transgenic varieties are strongly on the rise. In total, in 2004, developing countries accounted for almost 28 million hectares (ha), or 34 percent, of altland dedicatecl to transgenic crops (James 2004). Farmers' eagerness to adopt the technology, together with their success stories, is bad news for those antitechnology campaigners who base their arguments purely on scaremongering tactics.
Although opposition to genetically modified (GM) crops has been fierce since they were first released into the environment in the 1980s, the United States and a few other countries have managed to develop science-based biosafety regulatory systems. These have allowed the technology to flourish-as more than 80 million ha planted with transgenic crops worldwide in 2004 attest-for the benefit of farmers, consumers, and companies. Meanwhile, strang opposition in Europe managed to push through an extended de facto moratorium that has only recently begun to thaw.
This process is progressing only under aws seemingly designed to deter the use of transgenic crops rather than to encourage adoption of the technology. For example, under the present Gene Technology Act in Germany, farmers growing GM crops in a region are jointly and severally liable for economic damage that neighboring farms incur if their crops are contaminated by GM material, even if the sau ce of the material cannot be identified with certainty and the GM crop farmers have adhered to all regulatory requirements. The legal threshold level of admixture is arbitrarily set at 0.9 percent, but if a farmer has signed a contract to deliver produce that is free of GM material, then neighboring farmers of GM crops are fully liable for the loss in value caused even by admixture levels below 0.9 percent. In the present situation, German insurers are not prepared to sign contracts with farmers willing to grow GM crops, because the level of liability cannot be calculated. This policy creates an insurmountable hurdle to the spread of GM technology in the country.
One argument brought up by opponents of Golden Rice is that it might interfere with existing vitamin A supplementation and fortification programs and campaigns. This argument is used to suggest that we should opt for the status quo. Such an attitude disregards the potential of Golden Rice to provide viable, sustainable alternatives. Moreover, in adopting this position, opponents are ignoring the huge number of individuals-mainly in remote rural areas-not covered by most outreach activities. In lndia, a country with ongoing supplementation and fortification programs, 57 percent of children under six years of age show subclinical vitamin A deficiency, according to UNICEF. Another pertinent fact, which opponents seem to deliberately overlook, is that existing programs require millions of dollars per country every year to keep them going. These programs are not sustainable.
Initiatives promoting a more varied diet have met with limited success. This is because fruits and other food sources of provitamin A are not availaDle throughout the year. Moreover, many of these food sources da not grow in the areas where they are most badly needed. Most of all, people affected by vitamin A deficiency usually cannot afford to buy a varied diet. One strang argument for rice as a staple is that most alternative provitamin A-rich crops are perishable. Hence, subsistence farmers would be poorly advised to use up their scarce resources ta grow perishable crops that will not allow them to feed their families throughout the year.
1 believe Golden Rice will demonstrate that any legitimate concerns 3bout genetic engineering in any crop will be related to the specific traits being intr3duced, and not to the technology itseif. Golden Rice and the underlying technology have been widely discussed ever since Ingo Potrykus and Peter Beyer came up in 1999 with a rice plant capable of producing provitamin A. Provitamin A is normally produced in the green tissues of every plant and converted to vitamin A in the human body. Nobody has been able to come up with a scenario whereby the provitamin A-enriched grains of Golden Rice could pose a menace to the environment or to human health. What's left in the opponents' camp is a perceived risk of the technology as such, rooted in unfathomable, yet-to-be-articulated dangers. Meanwhile, real threat cloes exist: it is the threat of widespread micronutrient deficiencies killing millions of children and adults all over the world.
Opposition to GM crops is often based on the apparently reasonable argument that the public has a right to know and to decide. This argument remains simplistic at best if the decisionmaking process is not knowledge based but rather corisists of a summary rejection with a political undertone. This position has led tc politically motivated moratoria and the construction of insurmountable regulatcry hurdles. These hurdles have not only hit large corporations but also seriously affected developments coming from the public sector, leading to the loss of investments and opportunities. While development of a transgenic plant in the laboratory might cost a few hundred thousand dollars, fulfillment of regulatory requirements has amounted to several million dollars in same documented Gases. And this process must be repeated in every country where regulatory approval is sought. The lost opportunities are being felt especially in developing countries, where agricultural production could profit immensely from new resistance and adaptation traits in many crop plants (Cohen 2005).
In some Gases, opposition has led to the development of policies that exclude agricultural biotechnology in national research and development funding strategies. These days, more funds seem to go into biosafety research than into product development, with the result that few product development projects capture the public interest. For example, further development and deployment of Golden Rice have suffered severely because of lack of support from the European Union. The introduction of Golden Rice into target countries has been seriously delayed by the lengthy processes necessary to obtain permits to deploy seed for field testing. The main cause of these drawn-out procedures is that receiving countries have been influenced by the technology-rejecting position of several countries, most of them in Europe. The European position reverberates in distant nations: Zambia, tor example, rejected US donations of genetically modified maize, despite the severe grain shortage caused by a devastating drought in central and southern Arica; other nearby countries hit by the grain shortage also rejected the US-approved transgenic product.
A driving farce in establishing bureaucratic barriers is the fear of losing export markets tor agricultural produce because of potential "contamination"-a misnomer for the adventitious presence of transgenic crops-of export commodities. Socioeconomic studies are showing not only that the feared potential losses have been exaggerated but that huge advantages have been ignored. In a study of Asian countries published by the World Bank, the authors concluded that-in terms of health and direct economic improvements-export losses could amount to as little as one-half percent of potential gains. Total economic gains from Golden Rice could be in the range of several billions of US dollars for countries in Southeast Asia (Anderson et al. 2004). This kind of insight is slowly turning the tide, and is further under-pinned by scentific data that do not foresee any deleterious effects tc) mankind or to the environnient from the use of nutritionally enhanced rice (Lu and Snow 2005).
Some arguments by opponents of GM technology demonstrate a lack of basic knowledge of plant breeding. One such argument suggests that transgenes promote the use of monocultures. Transgenes, as opposed to many conventionally obtained traits, are mostly monogenic and are easy to breed into any locally adapted variety. The Golden Rice trait, for example, can be introduced into any local variety within two years, thus making it easy to preserve the cultivation of traditional varieties with added value (i.e., containing beta-carotene and thus having health-promoting characteristics).
Golden Rice has often been criticized for being a technical fix that does not address the real needs of farmers and their living conditions. Critics of Golden Rice go on to give their unqualified support to existing supplementation and fortification programs and to the growing of nontraditional vegetables in farmers' fields. Whle low-tech approaches are successful to a certain degree, these lifestyle-modifying interventions are often unsustainable. The genetic engineering step required to generate Golden Rice, on the other hand, involves a technological intervention. lts beauty is that it makes it possible to deliver a traditional crop plant with an added trait. A new variety of seed that can be grown, harvested, and replanted is the most down-to-earth and familiar solution known to any farmer. The only difference is that this new variety could, besides delivering daily calories, help solve a life-threatening problem. lt is a solution that, apart from initial outreach activities, will require no additional inputs. Golden Rice is a sustainable solution.
References cited
Anderson K, Jackson LA, Pohl Nielsen C. 2004. Genetically Modified Rice Adoption: Implications for Welfare and Poverty Alleviation. Washington (DC): World Bank. Cohen JI. 2005. Poorer nations turn to publicly developed GM crops. Nature Biotechnology 23: 27-33.
Greenpeace. 2005. Genmanipulierter Reis: Nicht wirksam und �berfl�ssig (3 August 2005)
James C. 2004. Global Status of Commercialized Biotech/GM Crops: 2004. New York: International Service for the Acquisiticn of Agribiotech Applications. ISAAA Briefs no. 32. (2 August 2005; www.isaaa.org)
Lu B-R, Snow AA. 2005. Gene flow from genetically modified rice and its environmental consequences. BioScience 55: 669-678.

Glassy-winged search continues
September 10, 2005
The Monterey County Herald, Calif.
Dania Akkad
Source: Knight Ridder/Tribune Business News
The search continued, according to this story, in Salinas, California on Friday for a winged pest capable of destroying Monterey County's lucrative wine industry.
By late afternoon, the crew scouring a residential neighborhood near the municipal airport and Highway 101 found no signs that the lone glassy-winged sharpshooter found in a bug trap Wednesday had any leaf-hopping company.
Since the discovery of the pest -- which has the ability to carry Pierce's Disease, an incurable grapevine killer that destroyed 14,000 acres of vineyards in Riverside County in 1999 -- inspectors from the commissioner's office have been searching the area for any other adult glassy-winged sharpshooters or signs of the insect's eggs.
They have also set up 35 additional traps around the location where the bug was found, with some of the yellow, cardboard traps going in residents' backyards.

Computer-aided farming levels off
September 11, 2005
Waterloo-Cedar Falls Courier, Iowa
Jon Ericson
Source: Knight Ridder/Tribune Business News
WATERLOO --- A study from the U.S. Department of Agriculture was cited as showing the boom time for computers on the farm has since leveled off, with only modest growth.
The story explains that the USDA surveyed more than 32,400 farms and found 55 percent either owned or leased a computer in 2004, just 1 percent more than in 2003.
Almost a third of those surveyed use the computer in their operations.
Business usage of computers also increased just 1 percent.
Computer use on the farm had grown at about 5 percent per year through the late 1990s and into the early 2000s.
Steve Johnson, an Iowa State University Extension farm specialist from Des Moines, was cited as saying the early adopters are all in, while aging farmers may have no interest in computers.
Johnson said the average age of farmers in Iowa is 57, and that rises to 65 for landowners.

EU pushes biofuel to fight climate change, high oil
September 11, 2005
Reuters
LONDON - The EU executive was cited as saying on Sunday that the European Union must increase the amount of biomass, a green fuel, in its energy mix as concerns about high oil prices and climate change mount.
EU Agriculture Commissioner Mariann Fischer Boel was cited as saying the European Commission would develop a "biomass action plan" by the end of 2005, which would propose ways to increase the use of the alternative energy source. New "ambitious" biofuel policy proposals could follow next year, she said.

1,3-dichloropropene risk assessment; notice of availability; extension of comment period
September 12, 2005
[Federal Register: (Volume 70, Number 175)]
[Page 53794-53795]
[DOCID:fr12se05-42]
[OPP-2005-0124; FRL-7738-2]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice; extension of comment period.
SUMMARY: EPA issued a notice in the Federal Register of July 13, 2005, concerning the availability of EPA's human health risk assessment and related documents for the fumigant 1,3-dichloropropene (1,3-D), which is commonly known as telone. This document is extending the comment period for 30 days, from September 12, 2005, to October 12, 2005.
DATES: Comments must be received on or before October 12, 2005.
ADDRESSES: Comments, identified by docket identification (ID) number
OPP-2005-0124, may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I.C. of the SUPPLEMENTARY INFORMATION of the July 13, 2005 Federal Register document.
FOR FURTHER INFORMATION CONTACT: Diane Sherman, Special Review and Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-0128; fax number: (703) 308-8041; e-mail address:sherman.diane@....

Dazomet risk assessment; notice of availability; extension of comment period
September 12, 2005
[Federal Register: (Volume 70, Number 175)]
[Page 53795]
[DOCID:fr12se05-43]
[OPP-2005-0128; FRL-7738-3]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice; extension of comment period.
SUMMARY: EPA issued a notice in the Federal Register of July 13, 2005, concerning the availability of EPA's human health risk assessment and related documents for the fumigant dazomet. This document is extending the comment period for 30 days, from September 12, 2005, to October 12, 2005.
DATES: Comments must be received on or before October 12, 2005.
ADDRESSES: Comments, identified by docket identification (ID) nubmer
OPP-2005-0128, may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I.C. of the SUPPLEMENTARY INFORMATION of the July 13, 2005 Federal Register document.
FOR FURTHER INFORMATION CONTACT: Dirk Helder, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-4610; fax number: (703) 308-8041; e-mail address: helder.dirk@....

Metam sodium risk assessment; notice of availability; extension of Comment period
September 12, 2005
[Federal Register: (Volume 70, Number 175)]
[Page 53795-53796]
[DOCID:fr12se05-44]
[OPP-2005-0125; FRL-7738-4]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice; extension of comment period.
SUMMARY: EPA issued a notice in the Federal Register of July 13, 2005, concerning the availability of EPA's human health risk assessment and related documents for the fumigant metam sodium. This document is[[Page 53796]] extending the comment period for 30 days, from September 12, 2005, to October 12, 2005.
DATES: Comments must be received on or before October 12, 2005.
ADDRESSES: Comments, identified by docket identification (ID) number
OPP-2005-0125 may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I.C. of the SUPPLEMENTARY INFORMATION of the July 13, 2005 Federal Register document.
FOR FURTHER INFORMATION CONTACT: Dirk Helder, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-4610; fax number: (703) 308-8041; e-mail address:helder.dirk@....

#4133

From: Doug Powell <dpowell@...>
Date: Tue Sep 13, 2005 2:13 pm
Subject: Agnet Sept. 13/05

dpowell@...

how to subscribe

WTO opens trade dispute proceedings to public for first time
September 13, 2005
Bloomberg.com
Warren Giles
The World Trade Organization has, according to this story, opened its doors to the public for the first time for hearings in a legal dispute over whether U.S. and Canadian sanctions against the European Union's ban on hormone-treated meat are illegal.
The EU says the sanctions, in place since 1998 and worth a combined $126 million, aren't merited because it has gathered scientific evidence to justify the moratorium in the interests of human health. The U.S. and Canada, in today's hearings, said the 25-nation EU has yet to prove it's carried out an adequate scientific risk assessment for its 16-year ban.
On the first of three days of hearings, which the three governments proposed opening to the public to promote transparency, the EU was cited as saying the U.S. and Canada have applied "a 'once a sinner, always a sinner' logic" since October 2003, when the bloc changed its legal basis for the moratorium.
The ban reflects the EU's "better-safe-than-sorry" food safety policy, known as the precautionary principle. The bloc pursued the same policy in biotechnology until last year, outlawing the import of genetically engineered foods because of safety concerns and prompting separate and ongoing complaints to the WTO by the U.S., Canada and Argentina.

Agnet Sept. 13/05

WTO opens trade dispute proceedings to public for first time

How rice survives an herbicide attack

Monsanto tests more Argentine soy in Europe

Crop studies feel a squeeze

The call of the female

Blunt, panel meet today on biotech future

Scientists get first glimpse at how plants, most animals repair UV-damaged DNA

Red vs white onions

Farmer seeking a cleaner spud

Alternative fuels will help country save on dollars

Weed out this law: Insecticide regulation is the responsibility of Ottawa and the provinces.

AACC international announces 2005 award winners

Turning evaporation ponds into arable land

Cyfluthrin; pesticide tolerance

How rice survives an herbicide attack
September 13, 2005
Checkbiotech
Katharina Schoebi
Weeds negatively affect crop production both quantitatively and qualitatively. To improve crop yields, herbicides are used for weed control. However, crops can also suffer from high herbicide concentrations � until now. Researchers in Japan have developed transgenic rice that is able to degrade various classes of herbicides.
Herbicides that combat weeds are laborsaving means for the improvement of crop yield and quality. Whereas mechanical weed control - by disturbing the soil - results in erosion and a loss of soil moisture, the application of crop protection products, leaves a biomass that helps conserve soil and moisture. That is why crop protection products such as herbicides are widely used in crop cultivation.
However, the extensive use of herbicides favors the evolution of weeds that are herbicide-resistant and some crops are suffering from the high concentrations of herbicides in the soil. The development of herbicide resistant weeds can be avoided by using various herbicides in rotation or in a mixture. To decrease the herbicide load in the soil, and to enable crop plants to grow under such an herbicide regime, both reduced application and degradation of the chemicals are needed.
From past research, scientists now know that the so-called cytochrome P450 monoxygenase (P450) degrades herbicides and thus renders plants resistant against some compounds. Information on vegetable P450s, which metabolize substances that do not belong to the organism itself, is limited.
In the liver of mammals, however, eleven P450s are known to be involved in the metabolism of foreign substances. These molecules have been well studied. Since they do not specifically degrade a certain range of compounds, they improve the animal�s ability to abolish a variety of unknown compounds. One very useful example is human CYP2B6, which is able to decompose various classes of herbicides.
Dr. Sakiko Hirose from the Plant Biotechnology Department at the National Institute of Agrobiological Sciences (NIAS) in Ibaraki, Japan, and her research team recently published their work about transgenic rice containing human CYP2B6 in the Journal of Agricultural and Food Chemistry.
In their studies, the researchers introduced the human gene cyp2b6 into Oryza sativa cv. Nipponbare. In contrast to non-transformed Nipponbare, the genetically engineered rice plants showed high tolerance to the herbicides alachlor and metolachlor, which otherwise inhibit the synthesis of very long chain fatty acids in plants. With Dr. Hirose�s enhanced rice, the inhibition of long-chain fatty acid production was no longer a problem, and no abnormal growth patterns were observable.
In the CYP2B6 rice variety, the researchers detected very little intact metolachlor, whereas in non-transformed Nipponbare rice, they found considerable amounts of the herbicide. In conjunction with this, the researchers also noticed a byproduct of metolachlor that signified that the transgenic plants had degraded the metolachlor. Both of these observations led Dr. Hirose to conclude that in the genetically modified rice, metolachlor is more quickly decomposed than in the non-transformed rice.
Three other herbicides, pyributicarb, pendimethalin and trifluralin, inhibited root growth or germination of Nipponbare rice. Yet, CYP2B6 rice varieties produced roots, grew better than the non-transformed Nipponbare rice and showed no bleaching in medium containing these herbicides.
However, the herbicide butachlor was an exception. Both non-transformed Nipponbare and transgenic rice showed nearly normal growth when treated with this herbicide.
In further studies, the genetically engineered rice containing P450 grew well in a pot with soil and water containing metolachlor, whereas Nipponbare plants were almost killed by the herbicide. Thus, the researches expect that CYP2B6 rice will also prove useful in degrading, and thus decreasing, the environmental loads of herbicides, insecticides and industrial chemicals in paddy fields and the connected water streams.
CYP2B6 rice varieties are tolerant to herbicides with diverse modes of action and various chemical structures. As a result, the application of numerous herbicides in rotation � to avoid the development of herbicide resistance - would not harm the crop.
When asked, if it could be possible that weeds also develop resistance to herbicides through gene flow from transgenic plant species, Dr. Hirose told Checkbiotech, �We cannot say zero tolerance regarding to crossability, however, it is considered that transgenic plants will be acceptable unless they have adverse effect on biodiversity, even if there are some wild species which may cross-pollinate with the transgenic plants. At least in mainland Japan, there are no wild weeds which can cross-pollinate with rice.� Thus, in the case of transgenic rice, it is considered that the development of herbicide tolerance in weeds through gene flow from transgenic rice varieties would be negligible.
Since human P450 species do not specifically degrade a certain range of compounds, modification of the production of these proteins in plants by genetic engineering may alter the patterns of secondary products in transgenic plants.
Thus, the researchers are considering that safety assessments of genetically altered plants producing P450 species are needed before they are used. �In the present social situation in Japan, it is difficult to grow any kind of transgenic plants in the fields,� Dr. Hirose added.
Co-workers of Dr. Hirose have already done some experiments with potato and tobacco that have the ability to degrade crop protection compounds as well. Dr. Hirose and her team are now planning on studying the ability of CYP2B6 plants to clean the environment from pollutants. To find out how you can support Dr. Hirose�s work, contact her at junmai@..., or at the information provided below.
Katharina Schoebi is a biologist and Chief Science Writer for Checkbiotech. Contact her at katharina.schoebi@....
Sakiko Hirose et al. Transgenic Rice Containing Human CYP2B6 Detoxifies Various Classes of Herbicides. Journal of Agricultural and Food Chemistry. (2005) 53, pp. 3461-3467
Link:
http://pubs.acs.org/cgi-bin/abstract.cgi/jafcau/2005/53/i09/abs/jf050064z.html

Monsanto tests more Argentine soy in Europe
September 13, 2005
Reuters
Hilary Burke and Karina Grazina
BUENOS AIRES - Monsanto Co. was cited as saying Monday that the company has tested more Argentine soy shipments in Europe for its Roundup Ready gene, to boost its case in Iawsuits aimed at forcing Argentina to pay royalties.
The story says that with the permission of importers, the U.S. biotech giant took samples of Argentine soy in Spain and elsewhere in Europe. An Agriculture Secretariat official was cited as saying on condition of anonymity that another sample was taken in Hamburg, Germany.
Monsanto Argentina spokesman Federico Ovejero was quoted as telling Reuters that, "We can confirm that voluntary samples have been taken in Spain as an additional tool for establishing our rights," adding that samples have been taken elsewhere but did not elaborate.
Earlier this year, Monsanto filed patent infriigement suits based on such samples in Denmark and the Netherlands against Argentine soy importers. Monsanto's Roundup Ready gene is patented in those countries, but not in Argentina.

Crop studies feel a squeeze
September 13, 2005
The News Observer
Peggy Lim
http://newsobserver.com/
CLAYTON� Commercial development is, according to this story, closing in on the Central Crops Research Station, where scientists carry out research on corn, tobacco, soybeans and most other crops produced by North Carolina farmers. Major Goodman, a renowned NCSU corn breeder and professor of crop science, statistics, genetics and botany, was quoted as saying that the station, owned by N.C. State University, is "the most important experimental station in the state."
The Wal-Mart shopping center arrived two years ago, enticing others to follow. Grand Plaza Shopping Center, with a Hardee's, Waffle House and other stores, opened across the street from Wal-Mart this year. An auto parts place is going up beside the station, and a day care center will open in November. Several adjacent, densely wooded tracts are for sale.
NCSU officials in Raleigh were cited as saying they are not about to sell the station. Winston Hagler, interim assistant director of NCSU's Agricultural Research Service, was quoted as saying, "It would be hard to find a good replacement."
The story says that fearing the lights from the Grand Plaza shopping center would mess up a sweet potato research plot, scientists moved the crop to a different location. Sweet potatoes require short days and long nights to flower and generate seeds.
Station employees also took a chain saw to about 120 apple trees because they didn't want their pesticide spraying to alarm Wal-mart customers. Station officials said they had no place to transplant the trees. The station's land is already crowded, and scientists are waiting in line for research space.
Most pesticides at the station are EPA-approved, but many people get nervous around spraying.

The call of the female
September 13, 2005
Checkbiotech
Shelley Jambresic
To ensure that reproduction occurs in flowering plants the egg and the sperm need to meet, otherwise fertilization fails. Failed fertilization is a big problem in agriculture. To improve the situation, Doctors Dresselhaus, Marton, Cordts and Broadhvest studied the attraction of the pollen by the female egg apparatus and found some new insights that could help increase fertility in agriculture.
Due to its inability to move on its own, the pollen of flowering seed plants needs to be transported to the egg by a pollen tube to allow double fertilisation. Double fertilisation means that two sperms (within a single pollen tube) are involved in the fertilisation. One sperm fertilizes the egg, producing the embryo and thus the next generation of the plant. The other combines with the polar nuclei of the central cell to produce the endosperm, a tissue that nourishes the developing embryo.
After pollen grains reach the flower, each sends out a tube, which carries its two sperms inside the flower where the egg and the central cell are located. However, little is known about the molecules, which the female egg apparatus produces to guide the pollen tube to the egg and the central cell. Dr. Dresselhaus and his research team from the University of Hamburg and Bayer Bio Science N.V., Gent, now identified one of the molecules, the Zea mays EGG APPARATUS1 (ZmEA1).
"ZmEA1 is exclusively expressed in the maize egg apparatus before fertilization," explained Dr. Dresselhaus. "It was no longer detectable at later embryo stages."
Similar forms of ZmEA1 were found in rice, but not in other plants. "We think that due to its very specific expression, genes expressed in the egg apparatus from other grass species are not available yet in the public database," Dr. Dresselhaus told Checkbiotech. Consequently, it has not been possible to compare the sequence of ZmEA1 to the genes expressed by other grass species.
"However, using the ZmEA1 sequence as bait, we identified a relatively high number of yet non-described proteins in the database that contain a so-called EA1-box," said Dr. Dresselhaus. "This is also the region showing highest similarity between rice and maize proteins." The EA1-box is also similar, but not identical, to other putative signalling proteins from grasses.
Dr. Dresselhaus suggests that the function of ZmEA1 orthologs in other grass species might be the same, and that the fact that the EA-1 box is not identical throughout different species indicates that the molecules guiding the pollen tube may be involved in the species-barrier concept. This concept helps ensure that only plants of the same species can reproduce resulting in fertilization by the same plant species only.
"We are planning to express the EA1 protein in the egg apparatus of barley and other grass species to increase fertilization rates with maize pollen." However, since pollen tube guidance is a very complex process, Dr. Dresselhaus is cautious. "We are realistic enough, where we will not promise that by using this single molecule we can attract pollen tubes from every species towards the maize."
Nevertheless, further research is being carried out by Dr. Dresselhaus� team. "Identification of the mature protein is in progress, and we will then try to identify the ZmEA1 receptor." Through their work Dr. Dresselhaus and his research team hope to provide a better understanding of the fertilisation barriers between plant species, which would result in increased inter-specific fertilisation rates and better tools to generate genetically modified plants.
To ensure their research in this area may continue, Dr. Dresselhaus and his research team submitted a proposal for a grant from a national funding agency. "Future work in this field will however depend on the results and achievement obtained during the next two years," Dr. Dresselhaus told Checkbiotech. "I may then establish a larger collaboration with additional partners to better understand and overcome crossing barriers."
Shelley Jambresic is a Science Writer for Checkbiotech in Basel, Switzerland.
"Micropylar Pollen Tube Guidance by Egg Apparatus 1 of Maize", Science Vol. 307, 2005.

Blunt, panel meet today on biotech future
September 13, 2005
St. Louis Post-Dispatch
Rachel Melcer
A panel, convened today by Gov. Matt Blunt, is, according to this story, charged with making Missouri a fertile place for plant biotechnology companies.
The group of nine state, industry and academic leaders will recommend ways in which Missouri can recruit firms and help them grow in this fast-moving and potentially high-paying industry.
They also will consider whether the state needs a regulatory structure to govern the sometimes-controversial planting of crops that have been genetically modified to produce proteins for use in polymers and drugs.
Roger Beachy, chair of the Governor's Advisory Council for Plant Biotechnology, and president of the Donald Danforth Plant Science Center in Creve Coeur, was quoted as saying Blunt "wants advice identifying what our niche is and providing him with recommendations that he can use to create the kind of structure needed to fulfill (Missouri's) promise. He recognizes that in order to go to that next step, we need to have the state play a role."
Missouri also wants to avoid mistakes such as those that stunted the plans of Ventria Bioscience, a cutting-edge California company that is moving to the Maryville campus of Northwest Missouri State University, said Jessica Robinson, the governor's press secretary.

Scientists get first glimpse at how plants, most animals repair UV-damaged DNA
September 13, 2005
Ohio State Research News
Pam Frost Gorder
http://researchnews.osu.edu/
COLUMBUS, Ohio � For the first time, researchers have observed exactly how some cells are able to repair DNA damage caused by the sun's ultraviolet (UV) radiation.
The Ohio State University study revealed how the enzyme photolyase uses energy from visible light to repair UV damage.
This enzyme is missing in all mammals, including humans, although all plants and all other animals have it. Greater understanding of how photolyase works could one day lead to drugs that help repair UV damage in human DNA.
In the online edition of the Proceedings of the National Academy of Sciences, Dongping Zhong and his colleagues report experimental evidence of what scientists have long suspected�that visible light excites the photolyase molecule and boosts the energy of electrons in its atoms. This in turn enables the enzyme to inject an electron into the DNA molecule at the UV damage site temporarily to perform repairs.
They also report something that was unexpected: Water plays a key role in the process, by regulating how long the donated electron stays inside the damage site before returning to the photolyase molecule.
Scientists believe that all placental mammals lost the ability to make this enzyme some 170 million years ago, said Zhong, an assistant professor of physics and adjunct assistant professor of chemistry and biochemistry at Ohio State.
That's why humans, mice, and all other mammals are particularly vulnerable to cancer-causing UV rays from the sun. But the rest of the animal kingdom � insects, fish, birds, amphibians, marsupials, and even bacteria, viruses and yeast � retained a greater ability to repair such damage.
Since the 1940s, scientists have been trying to understand how the DNA in plants and some animals can be damaged by UV light, and then � seemingly � repaired by visible light. In the 1960s, they identified the enzyme that was responsible for the repair, and named it photolyase, but they didn't know exactly how the enzyme worked.
By the 1980s, scientists proposed a mechanism for photolyase � that it donated an electron to damaged DNA � but nobody could prove it. The reaction happened too fast to be seen with normal laboratory tools.
Scientists also knew that the enzyme formed a tiny water-filled pocket to host the damage site within a cell nucleus, said Zhong. But until his latest series of experiments, nobody knew how water affected the reaction.
The Ohio State researchers mixed photolyase with UV-damaged DNA, and hit the mixture with a kind of blue strobe light to simulate the energy that it would receive from visible light.
Because the light pulses lasted less than a trillionth of a second, the researchers were able to make a very fast series of measurements to follow how the chemical reaction evolved over time.
They assembled their measurements together like a series of stop-motion photographs to reveal the individual steps of UV repair.
Zhong explained the damage and repair processes this way: When a UV photon strikes a portion of DNA, the atoms in the DNA molecule become excited. Sometimes an accidental bond forms between them. The bond is called a photo-lesion, and can lead to a kind of molecular injury called a dimer. Dimers prevent DNA from replicating properly, and cause genetic mutations that lead to diseases such as cancer.
In cell nuclei that contain photolyase, the enzyme forms a water-filled pocket with the right shape and size to accommodate the dimer for the repair. Normally, the enzyme wouldn't be able to reach the dimer, which is hidden inside the coiled DNA molecule, Zhong said. But electrical interactions between the DNA molecule and the enzyme cause the portion of the DNA that contains the dimer to flip outwards from the coil and into the pocket.
Then, when a photon of visible light hits the pocket, the enzyme becomes excited, and expels one of its own electrons into the dimer, which forces a rearrangement of the atoms in the DNA.
�From our work, we see that in less than a billionth of a second, the damaged DNA bases can recover their original form and the dimer will be gone, as if the UV damage never occurred,� Zhong said. But even within that short time, there's a danger of the donated electron jumping back to the photolyase enzyme before the repair is done.
Zhong's work has revealed how the water in the pocket performs a critical function at this point.
When the photolyase enzyme becomes excited, it jostles the water molecules, and that motion within the pocket delays the electron's exit from the dimer until just after the repair is done.
As far as scientists can tell, photolyase's only function is to repair DNA, and it's very good at it. The enzyme harnesses energy from the visible portion of sunlight to repair UV damage in plants and animals with 90 percent efficiency.
�Unfortunately, during evolution, mammals lost this enzyme,� said Zhong. �So we humans have more of a chance of getting skin cancer than an insect or a frog.�
Scientists would like to develop drugs that use photolyase's mechanism to repair UV damage in human skin, but they've had trouble with the first steps � replicating the photolyase reaction in the laboratory, and fully understanding it. Zhong hopes his latest study will change that.
�Maybe now that we know how light, enzyme, and water work together to control the timing, we can modulate this function and mimic what nature does,� he said. �We want to understand why this timing is so perfect.�
Zhong conducted this study with graduate students Ya-Ting Kao and Chaitanya Saxena and research associate Lijuan Wang, all of Ohio State, and Aziz Sancar of the University of North Carolina at Chapel Hill School of Medicine.

Red vs white onions
September 13, 2005
The Associated Press
Rukmini Callimachi
HERMISTON, Ore. -- Bob Hale was proved right in 1997, after pulling up his yellow onions and planting red ones, when Pizza Hut took the plunge and switched from yellow to red onions on all its pizzas. Two years ago, Subway, the nation's largest selling sandwich chain, embraced red, saying they added a splash of color to subs.
Now, the story says, large and small chains are experimenting with the brightly pigmented onion, a highly temperamental plant that takes far more skill to grow than its yellow cousin.
The National Onion Association was cited as saying that of the overall onion market nationwide in 2004, 88 percent were yellow onions, 7 percent were reds, up from 5 percent five years before, and 5 percent were white.
Fast-food chains are discovering what gourmet chefs have long known�a dish's visual presentation is almost as important as its taste.
On the Net:
National Onion Association: http://www.onions-usa.org/

Farmer seeking a cleaner spud
September 13, 2005
The Summerside Journal Pioneer
B5
In a province where potato is king, Marvin Webster is committed to making those spuds as clean as possible.
For Webster, whose family grows 650 acres for the processing sector on his farm on the Blue Shank Road under the corporate name Valley Grove Farms, it is a case of necessity being the mother of invention. He explained major processors across North America have encountered problems with debris in shipments taken to their plants. That debris can be anything from rocks to golf balls to (in rare cases) decaying animals. Many processors in other areas are now demanding all raw product brought to their plants be washed. While neither Cavendish Farms or McCain's are asking that of Island growers, Webster is convinced it is just a matter of time.
To help himself and other growers prepare for that eventuality, Webster has obtained funding from the P.E.I .ADAPT Council (which administers the Canadian Adaptation and Rural Development Fund in the province for Agriculture and Agri-Food Canada) to develop a mobile washer. He is now working with Bernard's Welding in Chelton on the design and manufacture of the product.
He explained many growers have warehouses spread out over a considerable distance and it doesn't make economic sense to have the potatoes trucked to one location to be washed. In his own case, there are three warehouses on the Blue Shank Road and another in Port Hill.
Webster explained much of the technology he is using has been around for some time - what he is trying to do is modify it to travel.
The first point of entry for the spuds into the new machine would be a flume system to help sort out rocks and other debris.
While such systems on stationary equipment are often 15-20 feet long, he has already been able to shorten it to four feet. The concept then calls for the spuds to go into a drum washer and then dried off to the point where they could be shipped under winter conditions. He explained if a potato is shipped dripping wet in winter, there is a possibility of freezing. The potatoes would then go to a grading table, where any debris missed could be sorted out.
Depending on the crop, if there was an abundance of smaller sized potatoes, they could also be taken out at that time. Webster said the machine could be moved from warehouse to warehouse as the shipment was being loaded. He said the manufacturer has already received some inquiries about when the technology will be on the market, "but we have a lot of work to do yet."
Webster said the machine would not be needed on the farm everyday, so it would present a chance for a number of producers in a given geographical area to purchase the equipment on a collective basis.
"I know in our case, we ship in June-July and again in November- December," he said. "The rest of the time we wouldn't need it."
Webster said he and the manufacturer are now working out the final design and they will then build a prototype for testing.
"We are quite a piece from commercial development yet, but I am pleased to see there is a fair bit of interest from growers," he said. "This could be marketed both on Prince Edward Island and in other potato growing areas since all processing growers are facing the same type of problems."
This is one of a series of articles prepared by the P.E.I. Agricultural Awareness Committee and funded by the P.E.I. ADAPT Council and other partners to highlight new and innovative developments in the province's farming community.

Alternative fuels will help country save on dollars
August 21, 2005
The Philippine Daily Inquirer
Philippines' Department of Energy
The Department of Energy (DOE) is promoting the use of indigenous alternative fuels to reduce the country's dependence on imported oil.
DOE is implementing four major programs under the Alternative Fuels Program: the Coco-Biodiesel Program, the Fuel Ethanol Program, the Natural Gas Vehicle Program for Public Transport, and the Autogas Program
Coco-biodiesel Program or CME Program
This was launched in April 2004 by President Macapagal-Arroyo to highlight the following qualities of coco-biodiesel: (1) it lubricates and burns well, and prevents carbon deposits (2) increases mileage by 1 km to 2 km even with 1 percent minimum blend, and (3) reduces emission levels by as much as 60 percent.
Memorandum Circular No. 55 mandated the use of 1 percent coco-methyl ester (CME) blend in all government diesel-fueled vehicles. In 2004, the use of CME in government vehicles resulted in cost savings of about P832,000. A total 30,261 liters of diesel was displaced based on 28 agencies that complied with the circular.
CME is similar to diesel that it can be used in diesel engine without modification.
Full implementation of the circular will result in potential savings of P21 million, equivalent to 977,000 liters of diesel a year. (See Table 1)
Table 1: Projected savings from diesel fuel displacement under CME program
Scope Blend Diesel displacement
(In million liters/annum) Forex savings*
(In million pesos)
Government 1 percent 0.98 21
Nationwide
1 percent
5 percent 54
271 1,193
5,989*Net Forex Savings = (Projected Diesel Displacement X Diesel Price) X 85 percent. Diesel price estimate at P26/liter exclusive of freight and other costs. Only 85 percent of projected forex savings were considered to account for the 15 percent imported methanol content.
Based on the estimates, a 1-percent displacement of diesel import will save the country about P 1.2 billion in foreign exchange. On the other hand, if 5 percent of imported fuel is displaced by locally produced coco-biodiesel, the government is expected to generate foreign exchange savings of P6 billion.
For the transport sector, the use of coco-biodiesel is expected to yield savings to motorists in terms of mileage efficiency. (See Table 2)
Table 2: Projected savings from mileage efficiency (for motori! sts) - CME
Product Price/liter
(in peso) Mileage*=
(km/li) Cost/km
(in peso) Savings/km
(in peso) Savings/li
(in peso)
A B C=A/B D E=BxD
Diesel 29 8 3.63
B1 Diesel (pre-blend) 29.37 9.5 3.09 0.53 5.07
B1 (Diesel +CME bottle) 29.91 9.5 3.15 0.48 4.56*Based in field test conducted by the Philippine Coconut Authority
The oxygen content in coco-biodiesel promotes better combustion in the engine, translating to an increase in mileage. Field tests conducted by the Philippine Coconut Authority (PCA) show that there is an increase in mileage by 1 to 2 km (or as much as 18 percent) from a minimum 1-percent coco-biodiesel blend in diesel. An 18-percent increase in mileage translates to savings of around 50 centavos per km or between P4 and P5 per liter.
Based on conservative estimates, if every diesel vehicle in the country increases mileage by 10 percent using 1 percent coco-biodiesel, diesel consumption will reduced by 540 million liters. At P26 per liter approximate price of diesel, the projected savings from the 10-percent increase in fuel mileage amount to P 14 billion. (See Table 3)
Table 3: Projected savings from mileage efficiency (for the country) - CME
2004 diesel demand 5,418 million liters
Mileage increase* 10 percent
Fuel savings from mileage efficiency
(diesel demand x 10 percent) 540 million liters
Forex savings** P14 billion*Estimated national average if all diesel fuel will use 1 percent CME.
**Per diesel price of P26/liter, exclusive of freight and other costs
The government will pursue the following strategies for expanding the use of CME: (1) ensure compliance of all government agencies with MC No. 55 as the government can provide a market to jump start demand for CME, (2) implement an extensive information campaign, (3) expand the use of CME in the power sector, (4) obtain stronger participation from stakeholders and ensure compliance of oil companies with Department Circular 2005-2004-003, and (5) pursue passage of a Bio-Fuels Bills and Renewable Energy Bill.
These strategies should make way for the full roll-out of the CME program.
Fuel ethanol program
The program was launched by the Pr! esident in May 2005 in San Carlos, Negros Occidental when she led the groundbreaking of the country's first bio-ethanol manufacturing plant of San Carlos Bio-Energy.
Ethanol is produced from crops such as sugar cane, corn, grain sorghum and wheat.
The program aims to replace 10 percent of imported gasoline with domestically produced fuel ethanol (initially at 5 percent while building new market for sugar and other feedstock such as corn and cassava) to promote cleaner air and to increase rural employment and income.
DOE is pushing for the passage of the Bio-Ethanol Bill, which provides for the mandatory use of 5-percent blend of ethanol in the second year of implementation. By that time, locally produced ethanol becomes available and could result in gasoline displacement of 236 million liters, equivalent to $129 million in foreign exchange savings per year. At 10 percent in the fourth year, the program could result in gasoline displacement of 536 million liters, equivalent to $294 million in foreign exchange savings per year. (See Table 4)
Table 4: Potential savings from the fuel ethanol program
Blend Gasoline displacement
(million liters) Forex savings per year
(million US$)
5 percent 236 129
10 percent 536 294
The President has issued Executive Order No. 449 on July 22, effectively reducing the tariff on bio-ethanol fuel. This would assure the price competitiveness of ethanol-blended gasoline vis-�-vis other gasoline products, especially now that there is no local producer of bio-ethanol fuel. The tariff reduction provides an incentive for the oil companies to start importing bio-ethanol fuel to make ethanol fuel available at gas stations.
Natural gas vehicle program
The mother station at the Malampaya On-Shore Gas Plant in Tabangao, Batangas had its groundbreaking in March 2005. It is expected to be completed this month, with the daughter station targeted for operation by September 2005.
To date, six bus operators have been accredited for the program. Targeted for commercial use by December are 200 buses running on compressed natural g! as (CNG).
Apart from cheap CNG price for the pilot program (at P14.52 per diesel liter equivalent), the initial fleet of 200 buses will result in potential foreign savings from diesel to be displaced. The savings are estimated at $4.72 million. The program may be expanded to 2,000 buses in 2006 using CNG sold at prices competitive with imported fuel.
Autogas (LPG) program
This program is being pushed by the government in line with the Clean Air Act of 1999 because the use of autogas results in almost negligible emission of toxic carbon monoxide.
To date, 108 autogas vehicles are operating in Metro Manila and 329 autogas taxis are running in Cebu City. Autogas vehicle operators claim that they can still save on costs at the current price of P21 per liter even if the distance traveled by autogas vehicles is 25 percent shorter than that by gasoline-fed vehicles.
The use of LPG will lead to up to 20-percent savings from oil ! change and tune-up, and prolonged engine life.
While LPG is an imported fuel, the program will help diversify sources of transport fuel and take advantage of cheaper supply of imported LPG.

Weed out this law: Insecticide regulation is the responsibility of Ottawa and the provinces.
September 13, 2005
National Post
FP19
Lorne Hepworth of CropLife Canadawrites in this column that no one wants to see money wasted by one arm of government repeating the work of another. Yet this is precisely what happens when municipalities pass bylaws that intervene in areas already well-managed by the federal and/or provincial levels of government.
Case in point: bylaws now in place in Toronto, Halifax and some 70 other municipalities across the country, which ban the use of pest control products.
The testing, registration, sale and application of pest controls such as herbicides and insecticides are already designated in law as the responsibility of the federal and provincial governments. Ottawa carefully handles the registration of all pesticides through Health Canada and its Pest Management Registration Agency (PMRA), while the provinces govern the sale, use, transportation, storage and disposal of pest control products.
This is ground already well covered by the senior levels. They have standing ministries and agencies which deal with these matters, staffed by trained professionals with the scientific knowledge and legal expertise needed to protect public health and the environment, while at the same time providing our farmers with the important tools they need.
So why do city councillors in Toronto, Halifax and many other municipalities feel the need to devote countless hours of their time, along with that of their support staff, council clerks, civic lawyers, compliance officers and the inevitable consultants�at a cost of untold thousands and thousands of dollars�to cut the same grass, so to speak?
This embodiment of waste and duplication is one reason my organization is seeking to challenge the city of Toronto's pesticide bylaw before the Supreme Court of Canada. This is a much bigger issue than dandelions on urban lawns.
The Supreme Court has already stated that lower-tier legislation that frustrates the purpose of federal legislation is unconstitutional and therefore unenforceable.
The current trend toward expanding municipal powers raises the prospect of a national patchwork of uninformed and unscientific restrictions on the use of products that federal regulators have already found, after scientific assessment, to be beneficial for Canadians. The power of municipalities to remove�without any scientific foundation�the benefits conferred by science-based federal legislation is an issue of national importance.
Because they're not equipped to properly assess complex products on a scientific basis, municipalities naturally default to an approach that effectively bans their use. In an effort to be seen to be doing something about a perceived risk, they ban pest control products altogether�with no regard for the impact of denying Canadians these products' benefits.
For urban residents, pest control products provide a safe and effective remedy to damaging weeds and insect infestations. For farmers�and the majority of the country's farms fall within some form of municipality�they are essential tools in providing quality, affordable foods. Yet those benefits are disregarded by municipalities that already have, or are considering, banning their use.
Here's an analogy: Pharmaceuticals are thoroughly regulated at the federal level by Health Canada. When taken according to label directions, pharmaceuticals can offer tremendous benefits for people suffering from a wide range of afflictions. But if they're not used properly�say, taken in too high a dose�there's a risk of harm. Municipalities could, conceivably, pass bylaws to prohibit people from taking certain medications on the premise of "protecting" them.
Fortunately, no municipality in Canada has put such a bylaw on the books. They are content to leave the matter where it belongs: in the hands of the federal regulator. So why won't they do the same with pest control products?
The Supreme Court must clearly delineate the jurisdictional border between municipalities and the senior levels of government. Costly, patchwork municipal bylaws based not on science but on political optics serve no one's interest, and instead waste huge sums of taxpayers' money.

AACC international announces 2005 award winners
September 12, 2005
AACC International Press Release
St. Paul, Minn � AACC International, formerly the American Association of Cereal Chemists, is pleased to announce the recipients of its 2005 honorary awards. The awards were given Monday, September 12 during the association's annual meeting in Orlando, Florida. This year�s award recipients include:
Robert Cracknell received the Geddes Memorial Award, one of the association's highest honors. The Geddes award is given in recognition of the leadership and dedication of the late William F. Geddes who served as AACC International president, vice-president, and Cereal Chemistry editor-in-chief. His service also extended beyond these roles and over the years Geddes influenced the association in significant and long-lasting ways. In 1961, the Geddes award was created to honor the zeal and unselfish industry of an individual member and to emphasize the importance of his or her contributions to the work of the association. Cracknell runs his own consultancy firm after retiring from AWB Limited (formerly the Australian Wheat Board) where he worked in a number of senior management and technical rolls for more than 33 years. Cracknell has held many roles within AACC International. He is currently chair of the International Executive Council and was instrumental in the recent name change.
The first Edith A. Christensen Award for outstanding contributions in analytical methodology was given to award's namesake, Edith Christensen. This award is in tribute for her many years of unselfish service to the society and recognizes her significant contributions to the advancement of analytical methodology. Christensen retired from the USDA in 1981 as chief of the rice and commodities branch of the Inspection Division of FGIS in Washington, D.C.
Jay-Lin Jane received the 2005 Alsberg-French-Schoch Lectureship award. This award, sponsored by the Corn Refiners Association, recognizes superior contributions to fundamental starch science. Jane is a professor in the Department of Food Science and Human Nutrition at Iowa State University.
John Taylor, professor in the Department of Food Science at the University of Pretoria, South Africa, is the recipient of the 2005 AACC Excellence in Teaching Award. The award is presented to an AACC International member and current teacher who has made significant contributions through teaching in the broad field of cereal science and technology.
George Inglett and Craig Morris were named AACC International Fellows, a distinction given in recognition of a member�s outstanding contribution to cereal science and technology. The award honors achievements in research, industry, leadership, education, administration, communication, or regulatory affairs. Inglett is the creator of TRIM technologies and is employed by the USDA ARS MWA NCAUR. Morris is director of the Western Wheat Quality Laboratory, USDA ARS, in Pullman, Washington.
AACC International is an international organization of 3,000 professionals who contribute to the research, development, and processing of grains and grain-based products.

Turning evaporation ponds into arable land
Source: Agricultural Research Service, USDAAgricultural Research Service, USDA
ARS News Service
Published: 12.sep.05
A unique way to reduce space-stealing evaporation ponds in California�and nurture a new crop in the process�has been developed by Agricultural Research Service (ARS) scientists and cooperators.
In the agricultural valleys of Central California, some evaporation ponds aren't worth keeping. Farmers who tend the region's heavily irrigated lands use these ponds to catch excess runoff draining from saturated fields.
On the west side of California's San Joaquin Valley, for every nine acres of land in production, one acre is needed for an evaporation pond, according to ARS soil scientist Dennis Corwin. For many growers in the valley trying to raise cotton, wheat and alfalfa, this can represent hundreds, if not thousands, of lost acres.
Not only that, but these vast ponds have also been found to contain concentrated salts and trace elements, including selenium, boron and arsenic, that can be toxic to wildlife and migratory birds seeking a watering hole in California's desert.
Corwin, who works at ARS' George E. Brown, Jr., Salinity Laboratory in
Riverside, Calif., and researchers at the University of California (UC) at
Davis and UC-Riverside experimented to see if water pumped from an evaporation
pond could actually be used to help nourish a tough and hardy forage crop.
If so, the pond's waters might start drying up, benefitting growers and wildlife and helping make less-arable land profitable again.
The team of soil, plant and animal experts is in the sixth year of their project. According to Corwin, the test crop�a salt-loving Bermuda grass�appeared to languish at first, given its less-than-favorable environment. But now it is lush and supporting a herd of beef cattle.
According to Corwin, the project exemplifies how even poor water and soil conditions can be overcome with the right combination of scientific knowledge and farmer expertise.
Read more about this research in the current issue of Agricultural Research
magazine, online at:
http://www.ars.usda.gov/is/AR/archive/sep05/saline0905.htm
ARS is the U.S. Department of Agriculture's chief scientific research agency.

Cyfluthrin; pesticide tolerance
September 13, 2005
[Federal Register: (Volume 70, Number 176)]
[Page 53944-53953]
[DOCID:fr13se05-19]
40 CFR Part 180
[OPP-2005-0205; FRL-7725-7]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes tolerances for residues of cyfluthrin in or on almond hulls, cucurbit vegetable crop group 9, fruiting vegetable group 8; grass forage; grass hay; grape; grape, raisin; leafy Brassica greens, subgroup 5B; leafy vegetable group, except Brassica, group 4; pistachio; pome fruit group 11; stone fruit group 12; tuberous and corm vegetable subgroup 1C; peanut; peanut, hay; pea and bean, dried shelled, except soybean, subgroup 6C; tree nuts, Crop Group 14; turnip greens; wheat forage; wheat hay; and wheat straw. Bayer CropScience and the Interregional Research Project Number 4 (IR-4) requested the tolerances under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA).
DATES: This regulation is effective September 13, 2005. Objections and requests for hearings must be received on or before November 14, 2005. ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VI. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under docket identification (ID) number OPP-2005-0205.All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Olga Odiott, Registration Division (7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-9369; e-mail address: odiott.olga@....

#4134

From: Doug Powell <dpowell@...>
Date: Wed Sep 14, 2005 3:09 pm
Subject: Agnet Sept. 14/05

dpowell@...

how to subscribe

Activist defends GM cargo ship protest
September 13, 2005
icWales
An environmental campaigner involved in a two-day protest on a cargo ship was cited as claiming today that at the time he believed it was carrying illegal and unapproved genetically modified crops.
The story says that a jury was told that Greenpeace had claimed the MV Etoile, which was stopped from heading into Bristol in June last year was carrying genetically modified animal feed.
The 123,000-tonne Panamanian-registered ship, one of the largest sea-going bulk cargo carriers, was eventually able to dock.
Ten men and three women all deny a public nuisance charge at Cardiff Crown Court.
Ben Ayliffe, 28, a Greenpeace employee involved in researching GM organisms, today told the jury that the aim of the protest was to stop the shipment coming into Bristol and to get it to return to the US.

Agnet Sept. 14/05

Activist defends GM cargo ship protest

Seven years lost for genetic engineering

Organic farmer wants P.E.I. to lead with ban on GMOs

Missouri Governor Blunt receives national biotechnology leadership award

When food from the laboratory leaves a bitter taste

Dow says it wins patent for biocrops

NSW: Ban on GM crops to be extended until 2008

Re: you are what you eat

Eastern gamagrass loves the heat

Super resistance to tackle major wheat disease

Alkyl (c10-c16) polyglycosides; exemptions from the requirement of a tolerance

Ethylhexyl glucopyranosides; exemption from the requirement of a tolerance

Carbofuran; risk assessment notice of availability

Pesticide product; registration approval

Seven years lost for genetic engineering
September 14, 2005
S. Hofmann
Handelsblatt
http://www.handelsblatt.de/
Translated by Katharina Schoebi, Checkbiotech
In mid-July, Monsanto Germany saw no other option other than to go through the courts. The German subsidiary of the US concern parent company filed suit at the administration court in Hannover to finally force a decision from the German Federal Cultivation Office on maize MON 810.
There have already been several years of tug-of-war surrounding the issue of the genetically altered maize variety. MON 810 is equipped with a gene that renders the maize resistant against the European corn borer, a dreaded pest.
Already in 1999, the EU approved the maize variety. However, in Germany, approval from the Federal Cultivation Office is also needed in order to commercialize the seeds.
The US seed company Pioneer made a first attempt as a Monsanto licensee in 2002, but the Federal Cultivation Office has repeatedly delayed their decision. At the end of 2004, Monsanto finally brought a MON 18-based hybrid through the two year test procedure as well. A decision was first expected in February 2005.
�And we were sure that our maize met the demands and would get the license,� said Monsanto�s speaker Andreas Thierfelder. However, the decision on MON 810 was postponed, after the German Federal Ministry for Consumer Protection, Food and Agriculture (BMVEL) objected, based upon genetic law provisions.
Subsequently, Monsanto contacted BMVEL and finally came to an agreement with the government office on a solution to the problem. The representatives from the ministry made assurances that no further legal concerns would be an issue for Monsanto�s maize. In return, the seed company committed to present � no later than at the start of commercial cultivation � a monitoring-plan that closely oversees the maize crops. Everything seemed to be again set for a decision.
However, at the end of May, a few days prior to the planned meeting with the Federal Cultivation Office, another veto from Berlin arrived. The office was instructed to postpone the decision based on the advice that the EU-authorization only applies to maize as animal feed and not to seeds. In discussions with the Ministry, Monsanto � by its own account - tried another time, even though it was futile, to clear up these concerns. In mid-July, when the EU-commission finally clarified that the permission for MON810 corresponded to the application of seeds, as well, the company decided to sue.
This episode is � from the vantage point of researchers and industry representatives � a typical example of the destiny of green biotechnology in Germany.
Scarcely another research area in the past years has seen itself so vigorously thwarted, delayed and constantly burdened with new barriers as plant biotechnology. Industry representatives regard the red-green government as seven lost years.
Dietmar Brauer, Director of the mid-sized seed company Northern German Plant Breeding, talks about a really �devastating� development. �Wherever the government established new rules, it has significantly exceeded the EU guidelines.�
From the vantage point of the seeds branch, there were some positive developments. Particularly, the gene technology initiative that was promoted by Federal Chancellor Schroeder promised some progress. The moratorium on crop testing would have been superceded with a requirement for a three year field trial for transgenic seeds. However in Berlin, under the effect of the BSE-crisis, the plans were already put aside 6 months later. Then Renate Kuenast, a Green party and vocal opponent of genetic engineering, took over the leadership of the newly created Ministry of Consumer Protection and Agriculture.
Industry representatives regard as especially serious the fact that the adjustment of the European release guidelines was first delayed for years, and was then finally accepted in German Genetic Engineering law with a really prohibitive liability rule. �In the overall package, the legal regulations are so prohibitive that it has made entry into several areas rather impossible,� Ricardo Gent, director of the German Industry Incorporation Biotechnology (BID), says.
For example, one serious hurdle is posed by the new German Genetic Engineering Law, which established a form of joint, as well as independent liability, for any varietly of genetically engineered seeds, regardless of negligence. In addition, out-crossings of permitted outdoor tests are classified as an unapproved use of genetically modified seeds � which, from the vantage point of the German Industry Incorporation Biotechnology, implicates incalculable liability risks for research.
�As a consequence of such liability risks, the number of outdoor field tests has declined by about two thirds since1999. Despite good basic research, Germany is losing their international status in product development in the area of green biotechnology,� DIB warns. �Scientific outdoor field trials tests would be increasingly restricted to crops such as potatoes, where no out-crossing is possible.�
However, research also perceives itself as being continually slowed down by the blockade politics of the Ministry of Consumer Protection and Agriculture. A few months ago, the fact that minister Kuenast stopped a project on research safety with the biological federal agency � under the control of to the BMVEL - caused for international concern.
A research group, led by professor Joachim Schiemann of Braunschweig, aimed to optimize the safety of genetically engineered plants with the project and successfully applied for federal grant money from the Federal Research Ministry. However, they had to withdraw their application under pressure from BMVEL.
Also on other occasions, researchers were apparently stopped. In autumn 2003 for example, the BMVEL stopped a trial with apple trees, whose release had already been approved by the German Commission for Biological Safety. NPZ-director Brauer refers to the publicly supported project Nanus 2000, where rape seed was to have been enriched with a gene for the constitutional fatty acid refiratol. When it came to the point where open field trials would have been required, the BMVEL prohibited them.

Organic farmer wants P.E.I. to lead with ban on GMOs
September 14, 2005
The Charlottetown Guardian
A3
Wayne Thibodeau
Raymond Loo, a Springfield, P.E.I. organic farmer, has, according to this story, been told he can no longer grow organic corn because genetically modified crops are being grown on a neighbouring field.
Loo was quoted as saying in an interview with The Guardian that, "We're in a situation, as organic growers, of having to meet the international organic standard which is zero tolerance for any kind of GMO in our products. They take it as a given that corn will cross-contaminate within 60 metres or the likelihood is high enough that it could happen."
Loo was further cited as saying he's not only worried about what is in the air above his farm but what may also be in the ground below his feet, including genetically modified soil bacteria.
Organic farmers need to produce an affidavit from the seed company saying the seed they use has not, in any way, been contaminated by genetically modified organisms or GMOs.
Wilbur MacDonald, chairman of a legislative standing committee examining the issue of genetically modified crops in P.E.I., was cited as saying his committee has been bombarded by people wanting to speak in the subject.
The story notes that hearings were held last spring and started again Tuesday. Three full days of hearing will be held this week with more hearings planned for next month.
MacDonald said he would like to conclude the hearings after that. His committee is expected to report back to the P.E.I. legislature this fall.

Missouri Governor Blunt receives national biotechnology leadership award
September 14, 2005
Kansas City Info Zine
http://www.infozine.com/
Blunt received the award during the initial meeting of the Advisory Council for Plant Biotechnology in St. Louis.
ST. LOUIS - Matt Blunt received the national Biotechnology Industry Organization (BIO) "Award for Leadership Excellence" for his support of bioscience industry development in Missouri. "Gov. Blunt has made development of innovative technologies a major tenet of his administration since being elected governor," said Hugh Grant, president and chief executive officer of Monsanto Corporation. "The governor understands the value and potential of the life sciences, particularly as they apply to making Missouri a world-renown center of excellence for technology development."
Blunt received the award during the initial meeting of the Advisory Council for Plant Biotechnology in St. Louis. Created by the governor earlier this year, the council will analyze the state's current life sciences environment to determine how the state can better capitalize on the industry's potential.
BIO represents more than 1,100 biotechnology companies, academic institutions, state biotechnology centers and related organizations in all 50 U.S. states and 33 other nations. BIO members are involved in the research and development of health-care, agricultural, industrial and environmental biotechnology products.
"Missouri is fortunate to have a committed public servant like Governor Blunt at the helm," Grant said. "The bioscience industry is fortunate as well to have an advocate as committed as Governor Blunt."

When food from the laboratory leaves a bitter taste
September 14, 2005
The New York Times
5
Stephen Holden
The heroes and villains in "The Future of Food," Deborah Koons Garcia's sober, far-reaching polemic against genetically modified foods, are, according to this column, clearly identified. The good guys, acknowledged in the film's cursory final segment, are organic farmers along with a growing network of farmers' markets around the United States that constitute a grass-roots resistance to the Goliath of agribusiness and the genetically engineered products it favors.
The bad guys, to whom this quietly inflammatory film devotes the bulk of its attention, are large corporations, especially the Monsanto Company, a pioneer in the development of genetically engineered agricultural products. In recent years, Monsanto has patented seeds that yield crops whose chemical structures have been modified to ward off pests.
The story says that the film poses many ticklish ethical and scientific questions:
Since genetic material is life, should corporations have the right to patent genes?
What are the long-term effects on humans of consuming genetically engineered food, which is still largely unlabeled in the United States?
Can the crossbreeding of wild and genetically modified plants be controlled?
Might genetically engineered food be the answer to world hunger?
And finally, could the reduction of biodiversity, which has quickened since the introduction of genetically modified plants, lead to catastrophe?
The film's answers to these five questions are: No. Possibly damaging. Probably not. Probably not. Possibly.
In each case, the movie outlines the pluses, the minuses and the imponderables. But the overall attitude of Ms. Garcia, the widow of the Grateful Dead guitarist Jerry Garcia, might be summed up with the scolding slogan "It's not nice to fool Mother Nature."
The story says that much of the film is devoted to Monsanto's prosecution of Canadian farmers on whose property the company discovered traces of its patented Roundup Ready canola seed, which is genetically engineered to kill pests. Though the seed had drifted accidentally onto the farmers' land, courts ruled that they had violated Monsanto's patent and were liable for damages.

Dow says it wins patent for biocrops
September 14, 2005
St. Louis Post-Dispatch
Rachel Melcer
Dow Chemical Co. was cited as saying Tuesday it won rights to a "broad and enabling" technology for creating genetically modified crops, such as those sold by Monsanto Co. of Creve Coeur.
Concluding a dispute between the two companies that has run for more than a decade, the U.S. Patent and Trademark Office awarded a patent to Dow AgroSciences LLC, an Indianapolis-based subsidiary of the chemical giant.
The patent applies to a method of transferring genes from a bacterium, Bacillus thuringiensis, to plants. The bacterium, known as Bt, kills certain insects.
Monsanto spokeswoman Lori Fisher was cited as saying the company has yet to review the patent ruling, but that Monsanto believes it holds sufficient patents on related technology to continue marketing and developing its products.
Still, Dow said the patent allows it to seek royalties from competitors, which use Bt technology to make corn and cotton plants resistant to certain destructive pests. And Fisher said she did not yet know if Monsanto could be held to royalty payments under the patent issuance.
Dow spokesman Garry Hamlin was cited as saying Dow's interests lie beyond collecting royalty payments and that it would rather use the patent as leverage to settle outstanding intellectual-property lawsuits, or to formulate cross-licensing deals for its competitors' technology, adding, "There is a lot of patent dispute in the biotech industry - essentially all major companies are involved in litigation. We see this as an opportunity for resolution of some of those disputes, as opposed to spending time in court, which is not very productive."
The patent could be challenged in court. Monsanto has not yet made any such decision, Fisher said.

NSW: Ban on GM crops to be extended until 2008
September 14, 2005
Australian Associated Press/ABC
SYDNEY - The state government was cited as saying that a ban an the cultivation af genetically modified (GM) crops in NSW will be extended until March 2008.
The stories explain that in 2003, the NSW parliament banned GM crops for three years until March 2006, but gave the government the power to allow exemptions for research purposes.
Primary Industries Minister lan Macdonald was cited as saying that because no on-farm GM research trials had taken place since 2003, there was insufficient evidence to help assess the benefits of GM versus non-GM food crops, adding, "Since no on-farm research into the marketing and trade aspects has occurred in NSW, the state government has decided to extend its legislation for another two years. � Such trials will go a long way in helping farmers making decisions about the technology based an robust independent science, as opposed at fear and bias."
Greenpeace GM campaigner Jeremy Tager was quoted as saying, "It's fantastic that the moratorium has been extended and now there needs to be commitment about how to deal with both the existing contamination determining its extent and its scope eradicating it, a commitment to zero tolerance in terms of contamination, and closing all the doors that are obviously open that allowed this contamination to have occurred several times now."

Re: you are what you eat
September 9, 2005
The Slovak Spectator
Letter
Lawrence Silverman
Via AgBioView at http://www.agbioworld.org
Re: You are what you eat, Volume 11, Number 33, August 29 - September 4,
2005
Foods produced through genetic modification (GM) technology are accepted by the scientific community around the world. They are transparently and extensively tested prior to any human consumption. As a result, they are beneficially and safely used by people worldwide.
Unfortunately, the recent Spectator article on this topic appears to have relied on fact-twisting and scare tactics contrary to the scientific realities regarding GM foods. The benefits of GM technology have been consistently recognized by global scientific organizations.
In a June 2005 study, the World Health Organization concluded: "The development of GMOs offers the potential of increased agricultural productivity or improved nutritional values that can contribute directly to enhancing human health and development.
From a health perspective, there may also be indirect benefits such as a reduction in agricultural chemical usage, enhanced farm income, crop sustainability and food security, particularly in developing countries. As the WHO study shows, acceptance of GM products is not just an American position. The European Food Safety Agency (EFSA) determined recently that EU member states had NO scientific basis for enacting safeguard measures against GMOs. In 2000, the Vatican's Pontifical Academy of Sciences stated, "Enhanced production of qualitatively improved food under sustainable conditions could greatly alleviate both poverty and malnutrition.
These are goals that will become even more urgent as our numbers increase by an estimated two billion additional people over the next few decades. Modern science can help meet this challenge if it is applied in an appropriately constructive social and economic context. Genetically modified plants can play an important role in alleviating world food problems.
Contrary to Greenpeaces assertion in the article that the Monsanto Corporation was hiding studies and documentation about its GM product MON 863, the entire report was already in the possession of many countries, including those in Europe.
In fact, the EFSA released the following statement after Greenpeace announced its "discovery": "The GMO Panel has given careful consideration to the arguments set out in the report.
Following its investigation of the report, and of the retrospective evaluation of renal tissues and data derived from the 13-week rat feeding study performed by independent peer reviews, the GMO Panel concludes that there is no evidence presented in the report that changes the conclusion already reached by the GMO Panel earlier this year in its Opinions on the safety of the insect-protected genetically modified maize MON 863 (EFSA 2004a, b). These opinions state that the results of the rodent toxicity study with MON 863 maize did not indicate concerns about its safety for human and animal consumption.
The Slovak Spectator article also presents the inaccurate view that farmers planting GM insect-resistant crops increase pesticide usage. In fact, farmers who use GM crops are able to increase their use of non-toxic phytocides. The use of caustic pesticides has dropped substantially as a result of GM crops. The increased use of these phytocides allows farmers to decrease tillage, save money on fuel, reduce tractor emissions, and save soil that would otherwise have been lost.
Finally, Greenpeace claimed that the recent visit to Slovakia of Madelyn Spirnak, Senior Advisor on Biotechnology to the United States Department of State, was nothing more than a lobbying effort on behalf of U.S. corporations. In fact, Ms Spirnak visited with Slovak government officials, NGOs, scientists, and lawmakers in order to better understand how the country is implementing EU and WTO requirements and what role biotechnology will play in Slovakias economic future.
GMOs have been used in agriculture for over ten years without a single health problem of any kind. The reality is that they have brought great benefits in needy areas, for example, substantially raising productivity among smallholder farmers in South Africa and vastly increasing cotton production in India.
Eighteen countries around the world, including Spain and Germany in the EU, the United States and Canada in North America, and Argentina in South America, are leading the way in implementing this technology.
These countries are not interested in coercing others to employ the technology, but simply want fair access to markets based on established scientific principles instead of artificial political barriers and alarmist rhetoric.
Lawrence Silverman Deputy Chief of Mission US Embassy, Bratislava, Slovakia

Eastern gamagrass loves the heat
September 13, 2005
ARS News Service
Agricultural Research Service, USDA
View this report online, plus any included photos or other images, at
www.ars.usda.gov/is/pr
The hotter it gets, the better eastern gamagrass grows. That's according to Agricultural Research Service scientists at the ARS Henry A. Wallace Beltsville (Md.) Agricultural Research Center. This means the plants not only could produce higher yields, but also store more carbon and therefore help mitigate the effects of high atmospheric carbon dioxide (CO2) levels associated with global warming.
ARS plant physiologists Donald Krizek, Dennis Gitz and V.R. Reddy and soil scientist Jerry Ritchie have obtained the first experimental proof that eastern gamagrass may outcompete other plants and store more carbon in a hotter climate.
The scientists simulated global warming conditions in outdoor climate-controlled SPAR (Soil-Plant-Atmosphere Research) chambers. They tested the plants at the current level of atmospheric CO2--370 parts per million�as well as at double that amount, the level expected around 2100.
Their experiments show that when temperatures were increased from 68 degrees Fahrenheit during the day and 57 degrees F at night to 95 degrees F in the daytime and 84 degrees F at night, eastern gamagrass plants could triple their carbon storage. The plants' leaves were bigger and contained twice as much nitrogen, raising their protein content. Temperature had far more effect on plant growth than C02 level.
Eastern gamagrass is often called "Queen of the Grasses" because it has so many good qualities. A hardy, warm-season grass, it not only tolerates and grows in marginal soils that are acid, compacted and waterlogged, it actually improves them. Eastern gamagrass also seems to withstand hot, dry conditions by closing the stomates on its leaves during the day to reduce water use.
At a time of year when cool-season grasses go dormant, eastern gamagrass provides high-yielding forage that is as nutritious as alfalfa. It also has potential for use in conservation plantings, as a bioenergy crop, and for making high-fiber flour.
Read more about this research in the September 2005 issue of Agricultural Research magazine, online at:
www.ars.usda.gov/is/AR/archive/sep05/carbon0905.htm
The research is also presented in recent proceedings of the Eastern Native Grass Symposia, held in Baltimore, Md. (1999), Chapel Hill, N.C. (2002), and Lexington, Ky. (2004). ARS is the U.S. Department of Agriculture's chief scientific research agency.

Super resistance to tackle major wheat disease
September 14, 2005
CSIRO Media Release
http://www.csiro.au/index.asp?type=mediaRelease&id=172stemrust&style=mediaRelease
Stem rust, the biggest disease threat to the Australian wheat industry is about to receive a huge knock back with four powerful stem rust resistance genes being located and 'flagged' with DNA markers.
With the genes now located, CSIRO Plant Industry's Dr Rohit Mago says he will use three or four of them to breed a 'super' stem-rust-resistant wheat with effective and long lasting resistance.
�By 'stacking' all the rust resistance genes into one wheat variety we can at least quadruple the chances the plant will be rust resistant � not just now but well into the future,� Dr Mago says.
Existing rust resistant wheat varieties save Australia's wheat industry from losing at least $300 million a year in lost production due to rust � a result of constant vigilance for new rust strains and breeding.
But rust is continually evolving into new strains and plant breeders have to keep finding new sources of resistance genes and breeding new resistance into wheat to keep up.
�Each of the four genes we are using is different and provides resistance to all current stem rust strains in Australia,� Dr Mago says.
�What's good about having four rust resistance genes working together in the one plant is that if one gene fails because a new rust strain overcomes it, you have three back-ups.
�One of the genes is 'tried and proven' and has been used for breeding in Australia and the others are 'cut down and improved' versions of genes that have not yet been used in Australia much.
�It is really unlikely that a new rust strain will evolve that will be strong enough to counter all four rust resistance genes at once.�
Although the four rust resistance genes were all previously known Dr Mago identified the DNA markers that flag the location of each of the genes in wheat.
�DNA markers are critical when using multiple genes in breeding because breeders can much more easily and quickly determine if a new wheat variety has the desirable resistance gene combinations � so breeding new rust resistant wheat varieties for growers is fast tracked,� Dr Mago says.
�Three of the rust resistance genes were previously associated with negative yield and quality traits, but in the new versions it looks like these drawbacks have been eliminated.�
Dr Mago has already bred plants with different combinations of two resistance genes and now hopes to combine three and four genes in the one wheat breeding line for field testing.
This collaborative research is supported by the Grains Research and Development Corporation, Waite Institute in Adelaide, SA and the Plant Breeding Institute in Cobbitty, NSW.

Alkyl (c10-c16) polyglycosides; exemptions from the requirement of a tolerance
September 14, 2005
[Federal Register: (Volume 70, Number 177)]
[Page 54281-54286]
[DOCID:fr14se05-12]
[OPP-2003-0362; FRL-7729-7]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes two exemptions from the requirement of a tolerance for residues of alkyl (C10-C16) polyglycosides also known as D-glucopyranose, oligomeric, C10-C16-alkyl glycosides when used as an inert ingredient in or on growing crops, when applied to raw agricultural commodities after harvest, or to animals. Cognis Corporation submitted a petition to EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA), requesting an exemption from the requirement of a tolerance. This regulation eliminates the need to establish a maximum permissible level for residues of D-glucopyranose, oligomeric, C10-C16-alkyl glycosides.
DATES: This regulation is effective September 14, 2005. Objections and requests for hearings must be received on or before November 14, 2005. ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit XI. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2003-0362. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Kathryn Boyle, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-6304; e-mail address: boyle.kathryn@....

Ethylhexyl glucopyranosides; exemption from the requirement of a tolerance
September 14, 2005
[Federal Register: (Volume 70, Number 177)]
[Rules and Regulations]
[DOCID:fr14se05-11]
OPP-2002-0166; FRL-7729-6]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes two exemptions from the requirement of a tolerance for residues of [alpha]-D-glucopyranoside, 2-ethylhexyl 6-O-[alpha]-D glucopyranosyl- and [alpha]-D-glucopyranoside, 2-ethylhexyl when used as inert ingredients in or on growing crops. Akzo Nobel Surface Chemistry LLC submitted a petition to EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA), requesting an exemption from the requirement of a tolerance. This regulation eliminates the need to establish a maximum permissible level for residues of these two ethylhexyl glucopyranoside chemicals. DATES: This regulation is effective September 14, 2005. Objections and requests for hearings must be received on or before November 14, 2005. ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit XI. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2002-0166. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Kathryn Boyle, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-6304; e-mail address: boyle.kathryn@....

Carbofuran; risk assessment notice of availability
[Federal Register: September 14, 2005 (Volume 70, Number 177)]
[Page 54377-54379]
[DOCID:fr14se05-68]
[OPP-2005-0162; FRL-7731-4]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: This notice announces the availability of EPA's human health risk assessment and related documents for the carbamate pesticide carbofuran, and opens a public comment period on these documents. EPA is developing an Interim Reregistration Eligibility Decision (IRED) for carbofuran through the full 6-Phase public participation process that the Agency uses to involve the public in developing pesticide reregistration and tolerance reassessment decisions. Through these programs, EPA is ensuring that all pesticides meet current health and safety standards. This notice opens phase 3 of the 6-Phase process. DATES: Comments, must be received on or before November 14, 2005. ADDRESSES: Comments, identified by docket identification (ID) number OPP-2005-0162, may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Stephanie Plummer, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-0076; fax number: (703) 308-7042; e-mail address:plummer.stephanie@....

Pesticide product; registration approval
September 14, 2005
[Federal Register: (Volume 70, Number 177)]
[Page 54379-54380]
[DOCID:fr14se05-69]
[OPP-2005-0199; FRL-7724-4]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: This notice announces Agency approval of an application to register the pesticide product, Mycogen Brand B.t. moCry1F Insect Resistant Corn Seed and Florbac Slurry containing active ingredients not included in any previously registered product pursuant to the provisions of section 3�7 and 3�5 respectively of the Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA), as amended.

#4135

From: Doug Powell <dpowell@...>
Date: Thu Sep 15, 2005 2:07 pm
Subject: Agnet Sept. 15/05

dpowell@...

how to subscribe

Australia-GM contamination
September 14, 2005
The Associated Press
Meraiah Foley
SYDNEY, Australia -- Traces of genetically modified canola have, according to this story, been detected in two varieties of nongenetically modified canola grown in western Australia, prompting calls by an environmental group Wednesday for stricter controls.
The Western Australia state agriculture minister, Kim Chance, was cited as saying that low levels of Monsanto Co.'s genetically modified, or GM, canola had been found at two sites growing conventional varieties of the plant.
Chance was cited as saying in a statement released late Tuesday that although the level of contamination, 0.04 percent, was well below the most stringent international standards for non-GM products, there was still cause for concern, adding, "Regretfully, the GM companies appear unable to contain their product ... and they appear unable or unwilling to respect Western Australia's moratorium."
Australia's federal laws allow the commercial use of GM canola, but laws in the major canola producing states, including Western Australia, ban the use of the seeds.

Agnet Sept. 15/05

Australia-GM contamination

Farmers divided on planting GM crops

Ventria on track to grow genetically modified rice in NW Mo

Brown doubtful Senate will pass food labelling law changes

Pizza farm

FAO warns world cannot afford hunger

Farmers divided on planting GM crops
September 15, 2005
The Charlottetown Guardian
Thibodeau, Wayne
Two P.E.I. farm groups want the right to plant genetically modified plants while a third farm group is calling for an outright ban on the technology.
The P.E.I. Potato Board and the P.E.I. Federation of Agriculture were both cited as saying that Island farmers should have the right to plant genetically- modified (GM) crops as long as the plants are approved by Health Canada.
But the National Farmers Union warns that such a move could be detrimental to P.E.I.'s farm community.
Danny Hendricken of the National Farmers Union was quoted as saying, "The Federation of Agriculture has taken a stand that it's up to the individual farmer to make the choice. I think that's rather unfortunate. It's either black or white. Either you're for it or you're against it. GM potatoes may be able to co-exist with other conventional and organic potatoes but that's only one of very few crops. Most crops, especially cereals, oil seeds and forage crops, are very prolific pollinators. I don't think that can happen."
During his presentation to a legislative standing committee examining GM crops Wednesday, Hendricken was further cited as saying that allowing GM products in P.E.I. will limit farmers choices - not increase them and that once they're here, there's no going back, adding, "There is a strong, overwhelming reluctance to consuming GM foods and we must accept that for what it is. It may already be too late for us to develop GM-free canola. Therein lies the danger. Even if we abolished GM canola now, it probably wouldn't be feasible to grow GM-free canola in P.E.I. and we've only been growing GM canola for a few years."
Kevin MacIsaac, a spokesman for the P.E.I. Potato Board and a farmer from Bear River, was cited as saying it's important local farmers have the choice to be able to grow GM products and that he grew GM Shepody potatoes in 1999, adding, "If the benefits of genetically modified potatoes were to become more widely recognized and accepted by consumers, we would like to have the choice of using this technology in fair competition with farmers in other Canadian provinces and in areas around the world. Potato producers feel provincial government policy should empower farmers and enable them to take advantage of technology advancement that will be of economic and environmental benefit."
MacIsaac was further cited as saying GM potatoes can benefit the bottom line, environment and worker safety and that GM potatoes need fewer trips through the field to spray, meaning a savings in fuel and chemical costs, less spraying also means less chance of runoff or chemicals affecting the environment and less spraying also means less of a risk for the farmers using the chemicals.
The story explains that in 1996, Sobeys grocery stores in the Maritime provinces introduced 10- pound bags of GM potatoes, called NatureMark that were clearly marked as genetically modified.
MacIsaac was cited as saying that even when priced at a premium, the potatoes sold quickly, adding, "Feedback from consumers was very positive, with many indicating that they were very pleased to purchase premium quality potatoes and know that it was 'grown a better way'."
But MacIsaac said a well-publicized anti-GM campaign scared off big potato buyers like McDonald's and McCains.

Ventria on track to grow genetically modified rice in NW Mo
September 14, 2005
Associated Press
Sam Hananel
WASHINGTON - Scott Deeter, president of Sacramento, Calif.-based Ventria Bioscience, was cited as saying Wednesday he expects to file an application soon with the U.S. Department of Agriculture to grow genetically modified rice in one or more locations within 50 miles of Northwest Missouri State University, which is in Maryville.
There were questions about whether the soil and climate in the region would be conducive to growing rice, but Deeter was cited as saying test patches of edible rice grown this year in both the northeast and northwest corners of the state yielded positive results, adding, "It's pretty amazing how well the rice did in both locations. All four of our trials this year went really well."
Ventria has been trying for months to win approval to grow so-called pharmaceutical rice in Missouri. The rice is enhanced with synthetic human genes that produce the proteins lactoferrin and lysozyme.
Margaret Mellon, food and environment program director for the Union of Concerned Scientists in Washington, was quoted as saying, "Our bottom line is there are hundreds of ways contamination could occur for them to all be successfully blocked if pharma crops are to be grown on a large scale in the United States."
High winds, birds and human error are just a few routes for modified rice to make its way into the food supply, Mellon said. Her organization opposes using food crops for pharmaceutical crop production.
Deeter was cited as responding that the risks are exaggerated and that Ventria officials take precautions to isolate genetically modified rice. Unlike corn and other crops, rice is self-pollinating, meaning the plant's male and female organs are contained within the same flower and its pollen needs to travel just a few feet.

Brown doubtful Senate will pass food labelling law changes
September 15, 2005
ABC
http://www.abc.net.au/
Changes to Australian food labelling laws will, according to this story, be debated in the Senate today, including the development of a website to give consumers chemical information about foods. Other features of the bill include banning products with foreign content from being labelled as 'made in Australia' and requirements for genetically modified (GM) foods to be identified.
Greens Senator Bob Brown is introducing the Bill but he is not confident of getting it passed.

Pizza farm
September 15, 2005
Associated Press
Jim Suhr
DOW, Ill.� Walt Gregory, a retired insurance agent and his business partner have, according to this story, carved up quite a tourist draw near the Mississippi River town of Alton, educating people with a half-acre circular plot divided up like the slices of a huge pizza.
The story says that each of the eight wedges represents something used on a pizza�from tomatoes to peppers to herbs including rosemary and sage. Three goats represent milk and Cleo the cow is symbolic of beef. Seven penned-in pigs illustrate pork.
The story notes that farmers increasingly are turning to inventive land use�cornfield mazes are another example�to supplement their bottom lines. Illinois, which is among the nation's leaders in pumpkin and horseradish production, is no exception.
The project seems to be working for Gregory and business partner Lynne Weis. They expect their organic pizza "demonstration" farm to draw 5,000 to 6,000 visitors this year, far more than the 1,500 visitors in 2004 or the 300 the year before that.
Gregory was further cited as saying he hopes to educate guests about organic growing and he makes no bones about his opposition to corporations behind agricultural biotechnology or farmers who use herbicide-resistant products he considers dangerous.

FAO warns world cannot afford hunger
September 15, 2005
Food and Agriculture Organization of the United Nations
http://www.fao.org/
NEW YORK/ROME - As world leaders met at the UN Summit in New York, the UN Food and Agriculture Organization (FAO) today called on the international community to honour commitments to cut world hunger in half by 2015.
The Rome-based food agency urged governments and private sector corporations to "adequately fund actions and initiatives that reduce hunger through rural development and reduction of rural poverty, while at the same time strengthening direct access to food by the most vulnerable."
Mobilizing resources to halve world hunger
In a publication on mobilizing resources to reduce hunger that FAO issued for the UN Summit, the organization warned: "It is unacceptable that 843 million people in developing and transition countries continue to be hungry and that more than 1 billion have to live on less than 1 dollar a day."
Unfortunately, says FAO, the rate at which hunger is being reduced is painfully slow, "slower than what is required to meet the World Food Summit goal, especially in Africa."
At the 1996 World Food Summit in Rome, Italy, leaders from 186 countries pledged to reduce the number of hungry people in the world by half no later than the year 2015.
According to FAO, to reduce hunger it is essential that a larger share of new development funding be allocated to agriculture and rural development than in past decades. The vast majority of the world's poor live in rural areas and research shows that agricultural growth, especially if focused on small farmers, is the most important engine for the creation of employment and income for the poor.
Agriculture is practised by farmers, not governments
The low level of public expenditure in national budgets and the long-term decline in official development assistance for agriculture and rural development in developing countries are totally at odds with the importance of agriculture in national economies, especially for the poorest countries which depend on agriculture, FAO's report said.
According to FAO, private investment is the key for total capital formation in agriculture and it is the responsibility of governments to make this possible through research, public investment regulation, financial incentives, and by building capacity.
"Agriculture is practised by farmers, not by governments," the Organization's report said. But inadequate public funding for essential public goods such as infrastructure, research and capacity building, and extension and market development has resulted in disincentives to private-sector activity and investment, the document added.
Promising signs for the future
FAO, with the International Fund for Agricultural Development and the World Food Programme, jointly produced another paper being circulated at the UN Summit - Eradication of poverty and hunger - that outlines a concise strategy to meet the first Millennium Development Goal (MDG) on hunger and poverty reduction.
FAO said there are "encouraging signs" of a strengthening of resolve to reduce poverty and hunger and meet the MDGs.
For example, the recent decision by African countries to increase the share of national spending on agriculture and rural development to 10 percent is "a most encouraging step toward overcoming public underfunding of the agriculture sector," the Organization said.
Also, many donor countries are pledging a substantial increase in development assistance. FAO cites the promise by the countries of the European Union to double official development assistance and the debt cancellation announced by the G8 concerning 18 of the world's poorest countries.

#4136

From: Doug Powell <dpowell@...>
Date: Fri Sep 16, 2005 1:42 am
Subject: Agnet Sept. 15/05 -- II

dpowell@...

how to subscribe

Greenpeace urges PEI to go GMO-free
September 15, 2005
From a press release
CHARLOTTETOWN - In a presentation today to the Standing Committee on Agriculture, Forestry and Environment, of the Legislative Assembly of Prince Edward Island, Greenpeace urged the government of PEI to become a Genetically Modified Organism (GMO) free province.
Greenpeace welcomed the extensive public consultations on GMOs on the island as a good first step. Greenpeace supports policies based on the precautionary principle and is opposed to the environmental release of GMOs because of the possible risks for preserving biodiversity.
"Making PEI GMO-free would be the best way to implement the precautionary principle as it has yet to be proven that GE (genetically engineered) crops or salmon are safe for either the environment or for human or animal health", said Eric Darier Greenpeace GE campaigner. "In view of the general failure of the Federal government to act responsibly regarding GMOs it is up to other levels of government to adopt measures to protect the environment, food and public safety."
The Federal government has so far failed to implement mandatory labelling of GE food, has yet to ratify the Biosafety Protocol, and most concerning has undertaken no independent and comprehensive scientific work to look into the impacts of GMOs on either the environment or human or animal health.
"Making PEI GMO-free is not only responsible from an environmental perspective, but it would enable PEI agricultural and fish products to respond to a global trend in consumer demand for non-GE food", added Darier. "A majority of Canadians and Islanders support the idea of PEI becoming a GMO- free zone. It is rare that a policy proposal is good for the environment, good for business, good for the farmers, and also has public support."
In a L�ger Marketing and CRA poll done for Greenpeace last February, 58% of decided respondents across Canada agreed that their own provinces should become GMO-free zones. In PEI this proportion was 62%.
Greenpeace urged PEI to:
1. End the planting of GE crops on the island.
2. Eliminate GMOs in animal feed
3. Oppose the authorization and commercialization of GE fish in particular GE salmon.
4. Put in place mandatory GE food labeling, like in Europe.
5. Adopt policies to foster ecologically and socially sustainable agriculture.
6. Publicize the island as a GE-free zone and encourage other governments
to follow suit.
Greenpeace urges Canadians to continue to support PEI's effort to become a GMO-free zone by sending messages of support to the Premier of PEI. ( www.greenpeace.ca/e/campaign/gmo/depth/pei_ge_free/index.php )

Agnet Sept. 15/05 -- II

Greenpeace urges PEI to go GMO-free

New grant ensures continuity of Pew Initiative work on agricultural biotechnology

New bio-economy web portal launched

Expertise, trust, and communication about food biotechnology

Stakes high in U.S./EC genetically modified crops dispute at WTO

New insight into how burdensome weed climbs surfaces

Plant pathologists: quick identification needed to save Florida�s citrus industry from devastating disease

Wormholes-yet another avenue for pollution?

New grant ensures continuity of Pew Initiative work on agricultural biotechnology
September 15, 2005
Pew Initiative on Food and Biotechnology News Release
http://pewagbiotech.org/
Washington, DC � A grant for $2.5 million has been awarded by the The Pew Charitable Trusts http://pewtrusts.org/ to the University of Richmond to continue the work of the Pew Initiative on Food and Biotechnology. This is the third grant received by the Pew Initiative since it was established in 2001.
In recent years, the Pew Initiative on Food and Biotechnology has produced reports, briefs and conferences to examine the controversial issues raised by the application of genetic engineering to agriculture. Topics have addressed the risks and benefits of current and future products of agricultural biotechnology, the adequacy of the U.S. regulatory system, and the challenges of marketing GM crops in a global marketplace deeply divided over acceptance of GM foods.
�We greatly appreciate the continued confidence of the Pew Charitable Trusts,� commented Michael Rodemeyer, executive director of the Pew Initiative on Food and Biotechnology. �These new funds will allow us to continue providing policymakers, stakeholders and the public with resources and information that address the evolving regulatory and market challenges presented by genetically modified foods and emerging products of agricultural biotechnology.�
�We are delighted that PIFB has become an important and respected player in highlighting the issues that agricultural biotechnology raises for consumers, industry and policy makers alike,� said Maureen K. Byrnes, director of Health and Human Services and Policy Initiatives for The Pew Charitable Trusts. �The Trusts� latest investment in PIFB will ensure that efforts to address those issues will continue to make progress.�
The new grant, which will cover the eighteen months between October 2005 and March 2007, includes a robust program that will:
Continue to focus attention on, and provide information to assist, USDA and other federal regulatory agencies� pending efforts to reexamine how they regulate agricultural biotechnology;
Take advantage of the growing interest at the state level about a variety of issues raised by agricultural biotechnology including the potential impacts on markets, the interactions between state and federal regulatory partners and ways in which adopters of different production practices can coexist; and
Highlight for public discussion the issues unique to future products of biotechnology such as pharmaceutical crops, transgenic animals and insects.
Additionally, the Pew Initiative will continue to track consumer opinion, update fact sheets on transgenic crops, and host public policy debates that respond to timely developments.
Staff Changes
Commencement of work on the third grant will coincide with several staff changes that become effective October 1.
Michael Fernandez, currently the Director for Science with the Pew Initiative, will assume the position of Executive Director and manage day-to-day operations of the Pew Initiative. Michael Rodemeyer, the Initiative�s founding director, will continue to work part-time on a number of Initiative projects while writing and consulting on other projects.
Kara Flynn has rejoined the Pew Initiative as Director of Communications after working with the National Pork Producers Council for the past three years. Kimberly Brooks, the current Director of Communications, will leave the Pew Initiative at the end of September to pursue other projects.

New bio-economy web portal launched
September 15, 2005
EuropaBio Press release
http://www.bio-economy.net/
Brussels - As a major EU Commission conference on the bioeconomy (1) opens today in Brussels, a brand new biobased economy portal is launched ( www.bio-economy.net The biobased economy is the new term for using renewable resources and new biological processes in our manufacturing base. Knowledge about the functioning of living organisms such as plants, bacteria, fungi, yeasts and their enzymes are enabling scientists and industry to use biological systems to produce much of the fuel, chemicals and materials needed by advanced societies. Examples are detergents that use enzymes to get rid of dirt, compostable plastics that are made from corn, and biofuels made from agricultural waste streams. Using processes based on biological systems, industry reduces the environmental footprint of many process industries. Some of these successes are little known: By replacing phosphates with enzymes in detergents, huge energy savings have already been possible because much lower temperatures are now needed to wash and launder clothes with a major reduction of phosphates in water streams and rivers.
�Biotechnology can make a major contribution to Europe becoming more sustainable and economically dynamic. There is a whole new industry just emerging that can develop these clean and competitive materials,� says Johan Vanhemelrijck, Secretary General of EuropaBio. The prospects for the bio-based economy are currently particularly favourable, in view of the sky-high prices for petroleum today. �Under the present European market conditions, finite fossil resources such as petroleum cost more than twice as much as renewable resources such as corn and wheat. So the development of the biobased economy is as inevitable as it is desirable,� says Prof. Wim Soetaert, Scientific Secretary of ESAB.
The new biobased economy website is for anyone interested in how biotechnology can contribute to a more sustainable industrial system relying more on renewable raw materials.

Expertise, trust, and communication about food biotechnology
September 2005
Food and Beverage Journal
William K. Hallman, Karen M. O'Neill, John T. Lang (Rutgers University)
Via AgBioView at http://www.agbioworld.org
Full article at http://www.fepsearchgroup.com/fbj/articles/article004.htm Experts typically presume to speak with authority about complex concerns, such as agricultural biotechnology. Research indicates, however, that the effectiveness of risk communication depends on perceptions about the trustworthiness of the institutions and experts providing information. This article explores how experts from a range of food-associated professions and institutions perceive their own roles in communicating about biotechnology. Most of the respondents rated scientists and other experts are most likely to tell the truth about biotechnology, but many felt that members of the public were most influenced by the mass media and by critics of biotechnology. In the United States, bioengineered grains are prevalent in the food supply, but bioengineering remains poorly understood by the public. Scientists and other experts with a stake in food technology have often suggested that public fears about bioengineering would be overcome if members of the public were given more information. Although there is some empirical support for this belief, a careful review of the existing literature finds the relationship between knowledge and approval of genetically modified (GM) food to be weak and the direction ambiguous. Moreover, communication about risk involves more than simply transmitting scientific information, and communicators need to consider organizational, contextual, and situational factors that shape reactions to perceived risks. In studies of reactions to risks, scholars increasingly cite the importance of trust in institutions and experts. Studies of the general population in the United States and Europe show that trust in information about genetically modified foods depends on the source. For example, large-scale survey research in the European Union indicates higher public confidence in doctors, university scientists, and non-governmental organizations (e.g., consumer and environmental organizations) than in governmental actors. Similar rankings are found in a survey of American consumers. Most of the existing research on hazard-related trust focuses on the trust ordinary people invests in elites and experts. There are undoubtedly several reasons for this, from theoretical imperatives to the methodological truism that ordinary people are more numerous and often easier to recruit into studies than elites. But this focus presents certain problems for both theory and practice. Ultimately, the sources these experts rely on and endorse as trustworthy have an advantage in influencing consumer opinion. So, who are the experts' experts? And whom do the experts present to the public as trustworthy?
Expertise, Technology, and Trust
One goal of this research is to consider how experts assess their own roles in debates about food biotechnology. Although the term expert includes a variety of actors, expertise in the United States usually centers on scientists and members of the professions. Scientists and professionals construct their authority in a given realm by applying specific methods of inquiry, by restricting entry to their profession through educational and testing requirements, and by creating ideologies that justify their professional methods and goals. For a time in the United States, scientists who developed biotechnology techniques presumed to speak as the chief experts on food biotechnology (Priest, 2001). Hannigan argues that the apparent acceptance of biotechnology by food scientists in the United States meant that few experts acted as public critics of this technology during its early years. More recently, a variety of critics have emerged to question the now well-established use of bioengineered products. Under these circumstances, the roles of experts have become more complicated. Given this, we propose two possible types of responses, one asserting the authority of experts and another expressing the idea that experts should work to de-mystify the technology for the public and to earn the public's trust. Although researchers have documented a general decline in the privileged position of scientists and professionals, it is also true that some experts have managed better than others to establish and retain prestige and privilege. Even though the authority of experts is not assured particularly during times of controversy experts might remain confident in asserting that members of the public should continue to trust them for information. We expect respondents who identify with this role to state that members of the public should trust experts to digest and present information about biotechnology or even assert that consumers have been prone to irrational reactions to biotechnology.
On the other hand, some experts might now believe that instead of acting as unquestioned authorities, experts should work to de-mystify biotechnology. Political activism in recent medical and scientific controversies-such as those concerning AIDS research or suspected cancer clusters-has often been coupled with skepticism about the priorities and authority of scientists. Within academia, the field of science and technology studies (STS) has attempted to deconstruct scientific authority by examining the mundane procedures of laboratories and other research sites. Studies also indicate that professionals have been losing prestige as they lose autonomy due to market pressures, legal constraints, and a general decline in trust in institutions. Some observers even question whether intellectuals and professionals have distinctive skills and personal qualities. Experts with this attitude might believe consumers should trust experts, but they may also accept that consumers will derive moral principles and other values from a variety of institutions. We expect respondents who identify with this role to state that members of the public are capable of understanding research findings and other relevant information, that experts should work to make such information readily available, or that experts must accept the influence of non-scientific institutions on debates about technology.
Because the public lacks the means by which to assess complex
technologies, trust in abstract systems, experts, and institutions
will ultimately determine the success or failure of any communication
about food biotechnology by critics or proponents. Biotechnology
began as a field with a clear set of experts, namely those scientists
who created the technology itself. As others join the debate,
expertise is being redefined. This study will identify some of the
concerns that motivate experts in a changing field as they attempt to
redefine their authority. Discussion
To date, most consumer studies of food biotechnology have focused on broad issues such as public awareness and perceptions about this technology. This study more specifically explored experts' assessment of the role of trust in communication about food biotechnology. Although the experts who responded to this survey named a variety of concerns about the future of biotechnology and the safety of the food supply, many highlighted the need for effective communication between experts and the public. Regarding experts' assessment of their own roles in the debate about biotechnology, we proposed two possible types of responses: one asserting the authority of experts and another expressing the idea that experts should work to de-mystify the technology for the public and to earn the public's trust. By first identifying inaccurate and incomplete communication as experts' biggest concern regarding food biotechnology, our results focused on the groups' experts found most trustworthy. Throughout the interview, experts revealed their preference for including diverse organizations and viewpoints. Overall, we found little support for the authoritative role of experts. Experts did not express frustration or believe consumers were behaving irrationally by seeking multiple sources of information. Rather, we found support for the role of expert as a reliable source of public information about biotechnology. Experts seemingly viewed food biotechnology as something that consumers were capable of understanding. Furthermore, experts thought it would be wise for the general public to come to their own conclusions about the technology rather than accepting any one group as an absolute authority. Respondents provided support for this more inclusive view of expertise in two main ways. First, experts expressed a concern that there was a communication failure when trying to inform the general public about food biotechnology. As reflected in the quotations, experts often looked beyond their own areas of specialty to help remedy this concern. In their responses to open-ended questions, few experts asserted their unique authority to digest and present information for the public. Many experts felt that consumers should use various sources of information about food biotechnology rather than relying on one type of organization. Some of the respondents advised using many sources, specifically because they believe that the popular media often provide consumers inadequate information. Second, we also found support for this more inclusive view of expertise in the rankings of groups that have the most influence over consumers. The high ranking of media and critical non-governmental groups suggests that the experts, who most trust science, fear that they themselves have failed to communicate scientific principles to the public. These rankings convey little support for the concept of expert as absolute authority. Many of the experts who value scientific assessments feel they should work to transmit scientific findings and concepts more effectively through the popular media. These findings also suggest that food experts in the United States have been somewhat humbled by the difficulties of communicating about biotechnology and that many acknowledge the importance of establishing trust.
Although there are obvious limitations to the generalizability of this sample, it is hoped that these qualitative results will serve as the basis for future research that will benefit from our observations. This study was conducted with a purposive sample of food experts in the United States; results might vary with other types of experts in other nations or on other topics. The use of an open-ended interview schedule and the rich descriptions that the respondents provide comes at the cost of limited quantitative data. Despite these constraints, however, several issues for future research on sources of trust in the context of food biotechnology seem to arise from these findings.
Most previous research on trust in experts has used ordinary citizens as evaluators of trust. However, expanding the evaluators beyond ordinary citizens is necessary if one is interested in identifying the views of those who might have particular influence on public opinion, whether food experts reach different judgments about biotechnology, or whether food experts might misinterpret or mismanage public opinion because they use different criteria. More detailed interviews with a larger sample of experts would allow differences of opinion across expert groups to be characterized and analyzed. Some of the differences between scientists and others in our sample suggest that experts in different institutions are motivated by considerably different concerns. Expertise may also be constructed differently across cultures. The reception of biotechnology has been cool or even hostile in many countries. The definition of, and meaning attributed to, trust is also related to cultural context. Systematic cross-national studies could test Hannigan's (1995) conclusion that experts contributed to public skepticism in other countries. Such studies could consider the political, organizational, and professional conditions that shape public trust in biotechnology.
Ultimately, members of the public will place their trust in specific institutions. Myriad expert groups attempt to influence these choices. Preliminary evidence indicates rising skepticism about agricultural biotechnology in the United States. Experts' beliefs about their own responsibilities and shortcomings will help determine which expert groups inspire trust.

Stakes high in U.S./EC genetically modified crops dispute at WTO
September 15, 2005
Institute for Agriculture and Trade Policy Press Release
New Backgrounder Outlines Key Issues - Ruling Expected Soon
Minneapolis - In the next month, the World Trade Organization (WTO) is scheduled to rule on a highly anticipated case that will directly impact how countries around the world regulate genetically modified (GM) crops and food. The Institute for Agriculture and Trade Policy (IATP) has outlined the key issues in a new backgrounder on the trade dispute between the primary plaintiff, the United States (joined by Canada and Argentina), and the European Communities (EC). The backgrounder can be found at: www.iatp.org In addition to ruling directly on the EC�s regulatory system for GM crops, the WTO ruling will set a precedent on food safety, public health and environmental health measures applied to internationally traded goods and services. The U.S. is the world�s largest user of GM crops. Most corn, soybeans and cotton grown in the U.S. are genetically modified. As of 2002, the U.S. State Department claimed at least $300 million in lost sales of GM corn and soy products to the EU.
�This case is about whether WTO members may use precaution when scientific uncertainties preclude regulators from assessing the risks not only of GM crops but also other new technologies,� said Steve Suppan, IATP�s Director of Research and author of the backgrounder. �U.S. regulators allow biotech firms to determine when biotech product risks merit regulatory concern. Now, the U.S. wants to export its deregulatory model to other WTO Members through this decision.�
The U.S. charges that by not approving a single new GM crop from 1996 through 2001, the EC regulatory system imposed a WTO illegal moratorium on new approvals without scientific basis. The EU countered it was developing a regulatory system during this period and that there is significant scientific uncertainty related to the health and environmental consequences of GM crops. The EC subsequently put in place a regulatory system for biotech products that has approved several new GM crops.
A ruling in favor of the U.S. would undermine the ability of regulators to consider broader regulatory objectives cited in the EC arguments, such as biodiversity conservation, and the EC�s ability to do independent assessment of biotech product claims and data. Developing countries, many of which have yet to establish regulatory regimes for GMO crops, will be particularly affected by this decision. Aspects of the ruling could also be applied to a threatened U.S. case against a draft EC regulatory plan to regulate more rigorously certain industrial chemicals for public health purposes.
The backgrounder identifies four central questions in the case:
1 - Will the EC and other WTO members be able to develop and maintain a regulatory system for GM crops that allows for the use of precautionary measures to protect consumer, animal and/or plant health when there is insufficient scientific evidence to assess the risks?
2 - Will the WTO agree that some of the EC�s regulatory objectives for GM crops fall outside of the WTO and are instead covered by other international agreements such as the Cartagena Protocol to Biosafety, which allow for a more precautionary approach?
3 - How will the panel document its use of expert opinion in determining the factual matters in the dispute?
4 - How will the panel use previous WTO dispute panel and appellate body rulings on �scientific uncertainty� to justify its ruling?
The backgrounder on the case can be found at: www.iatp.org http://www.iatp.org/ .
The Institute for Agriculture and Trade Policy works globally to promote resilient family farms, communities and ecosystems through research and education, science and technology, and advocacy.

New insight into how burdensome weed climbs surfaces
September 15, 2005
ARS News Service
Agricultural Research Service, USDA
View this report online, plus any included photos or other images, at
www.ars.usda.gov/is/pr
The way in which a problematic weed overruns and secures itself to crops and man-made structures�and how it clings to the surfaces it climbs�has been revealed by Agricultural Research Service scientists.
Redvine (Brunnichia ovata), a perennial woody vine that regenerates new growth from woody rootstocks and climbs by its tendrils, is a big problem for Mississippi Delta crops, especially soybeans.
Tendrils are organs used by some vines to assist their climbing, but little has been known about how they develop or support the vine. At the ARS Southern
Weed Science Research Unit in Stoneville, Miss., plant physiologist Kevin C. Vaughn and post-doctoral scientist Christopher G. Meloche discovered two unique aspects of redvine tendrils.
Redvine tendrils begin as straight, thin and flexible appendages of the shoot. Vaughn and Meloche discovered that epidermal cells along the length of the vine's tendril expand in response to touch by elongating toward a stimulus. The tendrils themselves, as a whole, respond by coiling around the object for support. Cells enriched with phenols break apart as the tendrils rub against the object. Then the phenols react with an enzyme, polyphenol oxidase (PPO), to produce a sticky, phenolic polymer cement used by the tendrils to stick to the vine's climbing surface.
This is the first time the PPO enzyme has been implicated in generating an adhesive in a climbing plant. In another first, the researchers also discovered that the weed's tendrils produce gelatinous fiber cells, the same structures found in leaning trees trying to right themselves. These fiber cells are also enriched in lignin to radically increase their strength. Then the cells automatically die, which leads to a dry, rigid coil structure securely anchoring the vine to the support.
The researchers found a unique cell wall composition with this process and are looking at steps in the metabolic pathways that might be inhibited to control redvine.
Read more about this research in the September 2005 issue of Agricultural Research magazine:
http://www.ars.usda.gov/is/AR/archive/sep05/vine0905.htm ARS is the U.S. Department of Agriculture's chief in-house scientific research agency.

Plant pathologists: quick identification needed to save Florida�s citrus industry from devastating disease
September 14, 2005
American Phytopathological Society Press Release
St. Paul, Minn. - The recent discovery of citrus greening (huanglongbing) in samples collected from trees in South Florida poses a definite threat to Florida�s $9 billion commercial citrus industry. Proper identification and eradication methods are needed to reduce the amount of crop loss caused by this disease, say plant pathologists with The American Phytopathological Society (APS).
Citrus greening is a bacterial disease that affects the phloem system of citrus plants causing the infected trees to yellow, decline, and possibly die within a few years. The bacterium is spread by an insect, the citrus psyllid.
"Although there is no cure for citrus greening, it is vital that plant pathologists work with growers to quickly identify the disease and its insect hosts," said Ronald Brlansky, professor and plant pathologist with the University of Florida, CREC, Lake Alfred, FL. "Finding the extent of the disease and the removal of infected trees will reduce the damage done by this disease," he said. Plant pathologists have been surveying and testing for citrus greening since the psyllids were found in the U.S. in the late 1990s.
Citrus greening infects all types of citrus species. The name "huanglongbing" means "yellow dragon" which is descriptive of the yellow sectors of infected trees. The symptoms of citrus greening usually include a blotchy mottle and leaf yellowing that spreads throughout the tree with lopsided fruit that fail to color properly.
Citrus greening has seriously affected citrus production in Asia, Africa, the Indian subcontinent and the Arabian Peninsula, and was recently discovered in Brazil.
The American Phytopathological Society (APS) is a non-profit, professional scientific organization. The research of the organization�s 5,000 worldwide members advances the understanding of the science of plant pathology and its application to plant health.

Wormholes-yet another avenue for pollution?
September 14, 2005
ARS News Service
Agricultural Research Service, USDA
View this report online, plus any included photos or other images, at www.ars.usda.gov/is/pr There's no doubt that earthworms benefit agriculture by their tunneling. But a recent study has shown that their burrows might also be funneling liquid manure - and possibly other contaminants - to underground drainage pipes. These, in turn, flush contaminated water onward, bypassing normal filtering and cleansing by soil.
Agricultural Research Service soil scientist Martin J. Shipitalo, at the ARS
North Appalachian Experimental Watershed Laboratory in Coshocton, Ohio, and
Frank Gibbs, with USDA's Natural Resources Conservation Service in Findlay, Ohio, did the study in no-till fields with liquid manure applied.
They found that water moved through wormholes twice as fast when the holes were within two feet of drainage pipes. The pipes provided outlets that helped the water flow along, instead of slowly percolating through small openings between soil particles.
The study suggests that the most practical solution is for farmers to install shutoff valves so they can turn off drainage during liquid manure application and for a short time afterwards. Some Ohio farmers already do this, with cost-sharing from the Ohio Department of Natural Resources. Another solution would be to install catch basins at the edges of fields to capture water draining from pipes and hold it for reuse. Both would help downstream water quality.
Worms - especially nightcrawlers - are especially attracted to no-till fields in areas that require drainage. They like the combination of no-till, drainage pipes, and the liquid manure farmers often apply to fields.
The worms eat the leftover parts of crops left on the surface by no-till, which skips plowing before planting, and they see the manure as food, too. The drainage pipes aerate the soil nicely, loosening it up for easy digging, especially the soil used to cover the drainage pipes. Plus, the crop residue offers them shelter, and with no-till there's no fear of a plow breaking up their tunnels.
Read more about this research in the September 2005 issue of Agricultural Research magazine:
http://www.ars.usda.gov/is/AR/archive/sep05/worms0905.htm
ARS is the U.S. Department of Agriculture's chief scientific research agency.

#4137

From: Doug Powell <dpowell@...>
Date: Sat Sep 17, 2005 7:02 pm
Subject: Agnet Sept. 17/05

dpowell@...

how to subscribe

France likely to use Spanish GM laws
September 16, 2005
AGRA Presse/Le Figaro
Translated by Katharina Schoebi, Checkbiotech
On July 19, the Spanish government published a royal decree that regulated the coexistence of genetically modified, conventional or organic crops. It marks the desire of the Zapatero government to strictly control GM crops in Spain, in contrast to the Aznar administration - which was less strict, with laws comparable to the United States, where GM crops do not have a special status.
There is good reason to bet that French regulations will be influenced by the Spanish laws. Actually, this is the only country in Europe that cultivates GM crops on a large scale (80.000 hectares of GM maize in 2005), and it is where French experts, in particular from Inra (http://w3.inra.fr/), have studied the risk cross-contamination by GM crops for several years. Since observing Spanish GM field trials, the French have been constructing practical models.
Spanish regulations
To start in future, the Spanish farmer - willing to cultivate GM crops - needs to warn the authorized authorities one month in advance and has to specify the variety and the introduced gene in the culture of interest. The farmer must adhere to specific rules for the preparation of the seed, the surveillance of fields, and the cultivation of the harvest. A security distance of 50 meters has to be kept between the fields of GM crops and other crops. The seeding period of the GM crops has to be declared compared to conventional varieties in order to prevent cross-pollination during blossoming. In addition, a buffer area of four rows of conventional maize, that is labeled as GMO, has to surround the GM field. In the case of maize resistant to the leaf-folder, 20 percent of the GM parcel has to be sown by conventional maize to hinder the development of resistance to the insect.
Additional regulations
The farmers must participate in education programs concerning GM cultivation. If a variety is deemed to be a source of contamination, it could be cancelled from the national register. Finally, the authorized persons from a region are charged with supervising whether the measures are well met.

Agnet Sept. 17/05

France likely to use Spanish GM laws

Argentina expects record corn harvest and more GM varieties

Investigation shows legal GMO from soy, not maize

BASF receives registration for CLEARFIELD� sunflowers

Can�t use it? Clear it out for free!

Integrating socio-econ issues in biosafety decisions

Mycogen gets patent grant on transgenic Bt in plants

Positive results for Swiss GM wheat field trials

Manure nourishing for crops

National Organic Program (NOP): proposed amendments to the national list of allowed and prohibited substances (crops and processing)

Fluoxastrobin; pesticide tolerances

GM Food Feed � Tolerance of adventitious presence of unauthorised material

Argentina expects record corn harvest and more GM varieties
September 15, 2005
Bloomberg
BUENOS AIRES � Agriculture Secretary Miguel Campos was cited as saying that Argentina will have a record crop of corn next year as farmers expand planting to take advantage of an increase in prices they expect in the aftermath of Hurricane Katrina in the U.S.
The story says that Argentina will export more than 10 million tons of corn next year to meet demand in international markets that U.S. farmers will fail to meet because of the damage Katrina did to southern U.S. ports, through which 70 percent of the country's corn and soybean crops passes.
Campos was further cited as saying the government will try to improve profit margins on corn by permitting new varieties of genetically modified corn, which will make it cheaper for farmers to produce the crop and help them alternate with soybeans to avert depleting soil nutrients.
Argentina last month allowed the planting of corn from Syngenta AG and in July allowed production of a variety produced by Monsanto Co.

Investigation shows legal GMO from soy, not maize
September 15, 2005
Rural News
http://www.ruralnews.co.nz/index.asp
The New Zealand Ministry of Agriculture and Forestry (MAF) (http://www.maf.govt.nz/mafnet/) and the New Zealand Food Safety Authority�s (NZFSA) (http://www.nzfsa.govt.nz/) investigations into a recent discovery of the presence of a genetically modified organism (GMO) in harvested maize grain show, according to this story, that this presence has not come from the maize itself, but rather from a residue of permitted imported soya bean meal held in the same storage or transport facilities.
On July 27, 2005, MAF announced that it was investigating a GMO-positive test result from a maize sample following routine industry testing.
The maize, stored in the upper North Island, was tested as part of normal quality assurance procedures and has been isolated while further investigations were completed. Those investigations included sending samples to an accredited overseas laboratory. None of this material has passed into the human food chain.
MAF eradication programmes manager Ian Gear was cited as saying that in addition to laboratory testing, MAF and the NZFSA have conducted an analysis of the storage and processing facilities involved, and had received full support from the companies involved as well as from the grain and seed industry, adding, "On the basis of all of the information we have received, we believe that the GMO detected here came from imported soya bean meal, rather than from maize. Laboratory testing of maize and soya bean meal have tested positive for a Roundup-Ready construct used in soy. This is approved under the Australia New Zealand Food Standards Code. Our site investigations show that the same facilities had recently been used for the storage of non-viable soya bean meal imported for livestock feed. Maize samples taken from other silos containing the same seed lines as those in the contaminated store have all tested negative to the presence of GMOs."

BASF receives registration for CLEARFIELD� sunflowers
September 16, 2005
From a press release
TORONTO - BASF Canada Agricultural Products has received the final federal regulatory approvals from the Canadian Food Inspection Agency and Health Canada for CLEARFIELD sunflowers. This approval allows BASF to pursue the development and commercial production of CLEARFIELD sunflowers in Canada for both oilseed and confectionary markets.
"The development of the CLEARFIELD sunflower production system is an important strategic initiative, as we continue to provide solutions for growers through our CLEARFIELD technology," says Scott Chapman, CLEARFIELD
Business Manager for BASF. "Once commercialized, the availability of CLEARFIELD technology in sunflowers will give Canadian growers - specifically those in the major sunflower-growing regions - access to the latest, innovative seed technology for this crop. As with all our CLEARFIELD systems, stewardship initiatives will be a key component of the commercialization of CLEARFIELD sunflowers, in order to maintain the integrity of the products and technology."
BASF currently markets CLEARFIELD production systems for both canola and wheat. These systems are comprised of non-genetically modified, herbicide-tolerant seed and broad-spectrum herbicides.
About BASF Agricultural Products
With sales of (euro) 3,354 million in 2004, BASF's Agricultural Products division is a leader in crop protection and a strong partner to the farming industry providing well-established and innovative fungicides, insecticides and herbicides. Farmers use these products and services to improve yields and quality of agricultural crops. Other uses include public health, structural/urban pest control, turf and ornamental plants. BASF aims to turn knowledge rapidly into market success. The vision of BASF's Agricultural Products division is to be the world's leading innovator, optimizing agricultural production, improving nutrition, and thus enhancing the quality of life for a growing world population. Further information can be found on the web at www.agro.basf.com Always read and follow label directions.

Can�t use it? Clear it out for free!
September 17, 2005
AGCare
Ontario Waste Agricultural Pesticide Collection Program
Now is your chance to get rid of unwanted agricultural and commercial pesticides. From November 22 to 23, 2005, take your unwanted agricultural and commercial pesticides to your nearest collection site for free and safe disposal. The two-day collection program will happen at 13 farm supply dealer locations across Ontario.
Transport your pesticides to the collection sites safely. For an information kit, including a list of collection sites and details on how to safely transport your pesticides, ask your farm supply dealer, call 1-877-424-1300 (toll free), or visit www.croplife.ca.
The following products will not be accepted: empty pesticide containers, treated seed, home/garden pesticides, paints, thinners, waste oils or any other household hazardous waste.
The Ontario Waste Agricultural Pesticide Collection Program is funded by CropLife Canada, the Ontario Ministry of the Environment, and Environment Canada. Funding for this project has also been provided by Agriculture and Agri-Food Canada through the Agricultural Adaptation Council�s CanAdvance Program. The program is also supported by AGCare, the Ontario Agri Business
Association and its network of participating agricultural dealers, and the Ontario Ministry of Agriculture, Food and Rural Affairs.

Integrating socio-econ issues in biosafety decisions
September 17, 2005
Crop Biotech Update
http://www.isaaa.org/kc/CBTNews/2005_Issues/Sept/CBT_Sept_16.htm#9
Environmental, health, and socio-economic concerns need to be considered in decisions regarding biotechnology. Governance mechanisms and opportunities for stakeholder engagement that can assist in minimizing risks while maximizing the potential benefits of the technology are proposed in �Integrating socio-economic considerations into biosafety decisions: The role of public participation,� a White Paper prepared by the United States-based World Resources Institute.
Lindsey Fransen and colleagues provide information and analysis on socio-economic issues related to agricultural biotechnology, and make recommendations to stakeholders for designing and implementing policies and mechanisms that incorporate socio-economic considerations in decision-making. It forwards the following aspects to integrate socio-economic issues:
Policies that mandate integration of socio-economic considerations into decision-making processes;
A clear definition of socio-economic considerations and explicit criteria to determine when socio-economic assessments are required;
Identification of the stages at which socio-economic assessments should take place;
Efficient and cost effective regulatory processes; and
Public participation mechanisms to ensure credible assessments and decisions that are more widely accepted.
Visit the World Resources Institute at http://www.wri.org/wri/.

Mycogen gets patent grant on transgenic Bt in plants
September 16, 2005
Crop Biotech Update
The United States Patent Office has granted patent rights to transgenic Bacillus thuringiensis (Bt) in plants to Mycogen Plant Seeds, Inc., an affiliate of Dow AgroSciences LLC. The newly granted patent for Bt in plants gives Dow broad and exclusive U.S. rights to this technology.
The patent was originally filed in 1988, but a decision by the U.S. Patent Office was delayed by interference proceedings by another company. The case was eventually resolved in Dow's favor. Dow's patent on transgenic Bt in plants (United States Patent Number 6,943,282) will be in effect until 2021.
For more information about Dow AgroSciences, visit http://www.dowagro.com or email Garry Hamlin of Dow AgroSciences at garryhamlin@....

Positive results for Swiss GM wheat field trials
September 16, 2005
Crop Biotech Update
http://www.isaaa.org/kc/CBTNews/2005_Issues/Sept/CBT_Sept_16.htm#9
The Federal Institute of Technology in Zurich, Switzerland reports that a field experiment on genetically modified wheat in Lindau near Zurich has yielded positive results. Swissinfo said that the study conducted between March to July 2004 tested wheat�s resistance to smut fungi.
The experiment confirmed laboratory results that the KP4 gene improved wheat's resistance to fungi by 10 per cent. Chistof Sautter, project leader, said that safety tests on pollen distribution and soil analysis also showed that the GM wheat posed no increased risk to humans or the environment.
Additional details from Swissinfo at http://www.swissinfo.org/
sen/swissinfo.html?siteSect=107&sid=6072405
cKey=1126188163000

Manure nourishing for crops
September 16, 2005
The Hanover Post
Garry Hoekstra
KEMPTVILLE�"Managing the nutrients in manure is one of the best ways to reduce fertilizer costs and build crop yields on the farm," says Keith Reid, Soil Fertility Specialist with the Ontario Ministry of Agriculture and Food and Rural Affairs. On Aug. 31, farmers, researchers and members of the agricultural industry met at the Central Experimental Farm in Ottawa to learn from Reid and others.
Reid pointed out that manure has nutrients the crops need. A crop of corn needs a lot of nitrogen, which manure has. But a soybean crop captures nitrogen from the air and does not need any more from manure.
So manure should usually go on corn ground and not soybean ground. Also, applying too much manure on land intended for wheat might cause the plants to fall over because the excess nitrogen in manure makes the wheat stems weak. Lodged wheat yields poor quality product and it is difficult to harvest.
Match manure application to the needs of the crop. If not enough nutrients are applied, the crop will be starved. If too much is applied the crop can't use it and the excess is lost to the environment.
The good news is manure is not a nuisance, but a resource. Organic matter in manure builds soil heath and the nutrients help save on the fertilizer bill.
This feature was produced with the assistance of the Agricultural Adaptation Council and Kemptville College, University of Guelph

National Organic Program (NOP): proposed amendments to the national list of allowed and prohibited substances (crops and processing)
September 16, 2005
Federal Register: (Volume 70, Number 179)]
[Page 54660-54668]
From the Federal Register Online via GPO Access [wais.access.gpo.gov]
[DOCID:fr16se05-21]
[Docket Number TM-04-01]
RIN 0581-AC35
AGENCY: Agricultural Marketing Service, USDA.
ACTION: Proposed rule.
SUMMARY: This proposed rule would amend the U.S. Department of Agriculture's (USDA) National List of Allowed and Prohibited Substances [[Page 54661]]
(National List) regulations to reflect recommendations submitted to the Secretary of Agriculture (Secretary) by the National Organic Standards Board (NOSB) from November 15, 2000, through March 3, 2005. Consistent with the recommendations from the NOSB, this proposed rule would add fifteen substances, along with any restrictive annotations, to the National List. This proposed rule would also amend the mailing address for where to file a Certification or Accreditation appeal. DATES: Comments must be received by November 15, 2005. ADDRESSES: Interested persons may comment on this proposed rule using the following procedures:
Mail: Comments may be submitted by mail to: Arthur Neal, Director of Program Administration, National Organic Program, USDA-AMS-TMP-NOP, 1400 Independence Ave., SW., Room 4008-So., Ag Stop 0268, Washington, DC 20250.
E-mail: Comments may be submitted via the Internet to:
National.List@....
Internet: http://www.regulations.gov.
Fax: Comments may be submitted by fax to: (202) 205-7808. Written comments on this proposed rule should be identified with the docket number TMD-04-01. Commenters should identify the topic and section number of this proposed rule to which the comment refers.
Clearly indicate if you are for or against the proposed rule or some portion of it and your reason for it. Include recommended language changes as appropriate.
Include a copy of articles or other references that support your comments. Only relevant material should be submitted. It is our intention to have all comments to this proposed rule, whether submitted by mail, e-mail, or fax, available for viewing on the NOP homepage. Comments submitted in response to this proposed rule will be available for viewing in person at USDA-AMS, Transportation and Marketing, Room 4008-South Building, 1400 Independence Ave., SW., Washington, DC, from 9 a.m. to 12 noon and from 1 p.m. to 4 p.m., Monday through Friday (except official Federal holidays). Persons wanting to visit the USDA South Building to view comments received in response to this proposed rule are requested to make an appointment in advance by calling (202) 720-3252.

Fluoxastrobin; pesticide tolerances
September 16, 2005
Federal Register: (Volume 70, Number 179)
[Page 54640-54651]
[DOCID:fr16se05-13]
40 CFR Part 180
[OPP-2003-0129; FRL-7719-9]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes tolerances for combined residues of fluoxastrobin, (1E)-[2-[[6-(2-chlorophenoxy)-5-fluoro-4-pyrimydinyl]oxy]phenyl](5,6-dihydro-1,4,2-dioxazin-3-yl)methanone O-methyloxime, and its Z isomer, (1Z)-[2-[[6-(2-chlorophenoxy)-5-fluoro-4-pyrimydinyl]oxy]phenyl](5,6-dihydro-1,4,2-dioxazin-3-yl)methanone O-methyloxime, in or on leaf petioles subgroup 4B; peanut; peanut, hay;
peanut, refined oil; tomato, paste; vegetable, fruiting, group 8; and vegetable, tuberous and corm, subgroup 1C. This regulation also establishes tolerances for the indirect or inadvertent combined residues of fluoxastrobin and its Z isomer, in or on alfalfa, forage;
alfalfa, hay; cotton, gin byproducts; grain, cereal, forage, fodder and
straw, group 16; grass, forage; grass, hay; and vegetable, foliage of
legume, group 7. This regulation additionally establishes tolerances
for the combined residues of fluoxastrobin, its Z isomer, and its
phenoxy-hydroxypyrimidine metabolite, 6-(2-chlorophenoxy)-5-fluoro-4-
pyrimidinol, expressed as fluoxastrobin, in or on cattle, fat; cattle, meat; cattle, meat byproducts; goat, fat; goat, meat; goat, meat byproducts; horse, fat; horse, meat; horse, meat byproducts; milk;
milk, fat; sheep, fat; sheep, meat; and sheep, meat byproducts. Bayer CropScience requested these tolerances under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA).
DATES: This regulation is effective September 16, 2005. Objections and requests for hearings must be received on or before November 15, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VII. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2003-0129. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on
the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S.Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Tony Kish, Registration Division (7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-9443; e-mail address: kish.tony@....

GM Food Feed � Tolerance of adventitious presence of unauthorised material
September 16, 2005
European Commission, Health and Consumer Protection
The complete document of the following can be downloaded from:
http://europa.eu.int/comm/food/food/biotechnology/gmfood/tolerance_en.htm
Limited number of events (pdf) Updated

#4138

From: Doug Powell <dpowell@...>
Date: Mon Sep 19, 2005 8:40 pm
Subject: Agnet Sept. 19/05

dpowell@...

how to subscribe

GM-free stance costs Australia
September 19, 2005
ABARE
http://www.abareconomics.com/
Australia�s GM-free stance on planting transgenic canola could result in significant losses for Australian farmers, according to the September issue of Australian Commodities released today by Dr Brian Fisher, Executive Director of ABARE.
Although Australia�s gene technology regulator has approved transgenic canola for commercial planting, state and territory legislators have established moratoriums prohibiting the growing of transgenic canola. Moratoriums on commercialising transgenic canola currently exist in all states and territories except Queensland and the Northern Territory.
�ABARE modeling has found that failure to commercialise transgenic crops now and in the near future could, by 2015, cost Australians $3 billion,� Dr Fisher said.
Continued growth in the adoption of transgenic crops and continued development of new varieties of transgenic crops in Asia and in north and south America will potentially result in Australian grain and oilseed producers competing with increasing volumes of transgenic grains and oilseeds in export markets. This is likely to result in lower profitability and lower market share for conventional grain crops, which are more expensive to produce than transgenic varieties.
�The current moratoriums are having a negative impact on Australia�s research and development effort, and Australia risks being left behind as other nations embrace innovations in transgenic crop development,� warned Dr Fisher.
Australian canola producers are already competing with transgenic canola seed in their major export markets. Australian producers of other conventional grains also face a future in which they potentially are forced to compete with lower cost transgenic crops grown in Asia and in north and south America.

Agnet Sept. 19/05

GM-free stance costs Australia

French maize farmer sees more GMO converts

Denmark drops outright ban on genetic modification

Rajma from China now

China approves new GMO cotton to raise output

Water management key to survival in face of potential food production crisis

GMOs can benefit the farmer, society and the environment

Making plant cells work like miniature factories

Harmful Organisms - Third Country Imports - Inspection of Imported Products

Fall and winter cover crops � can nitrogen be �trapped� for next year�s crop?

End of season cornstalk nitrate-n test

Nitrogen for corn in 2006

French maize farmer sees more GMO converts
September 19, 2005
New Brisbane�s News
Muriel Boselli
http://www.leadingthecharge.com/
PARIS - When Pierre, a 50-year-old French maize farmer, was offered the chance to grow his first genetically-modified (GMO) crops, he jumped at the chance and, according to this story, predicts many others will soon follow suit.
Pierre, a farmer in southwest France was quoted as telling Reuters by telephone, declining to give his full name, that "Before I decided to grow GMO maize there was a lot of debate in my family."
The story explains that with around 50 hectares sown to conventional maize, Pierre decided to take part in a program organized by France�s maize growers association (AGPM) to study the effects of growing traditional and GMO varieties side-by-side.
He agreed to grow one hectare of GMO maize, which although part of an experiment, will be sold commercially to the animal feed industry in Spain, where GMOs are widely grown and used by feed compounders.
The story adds that Pierre is one of around 40 to 50 maize growers in the region, who declared commercial GMO plantings of some 500 hectares. The maize was one of the varieties approved by the European Commission before its unofficial moratorium on new authorizations came into effect in 1998.
Although the moratorium was lifted last year, no new strains have yet been approved for commercial growing. In or before 1998, approval was given for 18 biotech plants, including maize, rapeseed, chicory and soybeans.
Some, like Pierre, are part of the AGPM program, others are just growing it commercially.
But the precise number of farmers who have opted for gene-spliced crops is difficult to pin down because of a legal vacuum in France, which means farmers are not yet legally obliged to declare the new strains.

Denmark drops outright ban on genetic modification
September 19, 2005
AFP
After vehemently opposing genetically modified organisms (GMO) for eight years, the environment ministry was cited as saying Denmark is set to authorize the importation of modified maize.
The story says that the Danish government, which has long been in favour of GMOs but has been unable to obtain a parliamentary majority on the issue, will inform the European Commission of its change of heart next week after finally managing to convince a sufficient number of MPs.
Environment Minister Connie Hedegaard was quoted as saying in a statement that, "The time has passed when Denmark automatically said 'no' to GMOs and (the country) now intends to take a more nuanced approach on a case-by-case basis. If well-used, GMO technology holds great opportunities. � We cannot allow ourselves to reject this technology just because it is new and incomprehensible to us."

Rajma from China now
September 19, 2005
The Hindustan
Chetan Chauhan
http://www.hindustantimes.com/
NEW DELHI -- China is preparing to offer a genetically modified rajma that has an edge over the Indian kidney bean because it is cheaper and easier to cook.
The story says that the GM bean does not need soaking for hours.
A wholesaler in Delhi's cereal market Naya Bazaar was quoted as saying ,"Soak it in lukewarm water for 30 minutes, pressure-cook for 30 minutes, and it's ready."
A scientist at the Energy and Research Institute was quoted as saying, "China has done lot of work on GM beans. Since production of GM beans started in China, the country has surplus produce of beans and it is being exported. That may be the reason the Chinese produce is cheaper."
According to Naya Bazaar dealers, its demand is increasing in city markets, but the sale is restricted to poorer parts of the city at the moment.

China approves new GMO cotton to raise output
September 19, 2005
Reuters
BEIJING -- Zhang Rui, a member of a research team under the Chinese Academy of Agricultural Sciences, was cited as saying that China, the world's top grower of genetically modified (GMO) cotton, has approved commercialising a new hybrid variety, which should help the country cut its production shortfall in the commodity.
Rui was further cited as saying the hybrid variety of insect-resistant Bt cotton�which contains a bacteria that kills bollworms�would yield 26.4 percent more cotton than the current strains, including one developed by biotech giant Monsanto Co., adding, "The new hybrid strain won approval this year and we expect it will be grown in large areas from the year after next."
China, the world's top consumer of cotton, is expected in the 12 months to August 2006 to import as much as 3.2 million tons of the fiber, the largest amount ever imported by a single country, due to smaller acreages and larger textile exports.

Water management key to survival in face of potential food production crisis
September 18, 2005
From a press release
BEIJING - Water management is fundamental to averting a potential crisis in global food production, according to world experts who met in Beijing for an important international forum concluding Sunday. The meeting of the International Commission on Irrigation Drainage (ICID) highlighted the urgency of promoting greater attention and discussion of water management impacts on food security and environmental sustainability, during a weeklong session of ICID's 19th International Congress and 56th International Executive Meeting. In light of the urgency of continuing dialogue on these issues ICID also reinforced its commitment to participating in the 4th World Water Forum (WWF) to be held in Mexico City next year in March.
"Participation in the 4th World Water Forum, is an important step in seeking solutions for development with due care for the environment. These are among the most urgent issues facing the international community today. The world population is still growing rapidly and it is important that we take appropriate measures now to ensure the survival of various communities throughout the world," M. GopalaKrishnan, Secretary General of the ICID.
"By 2025, 2.7 Billion people, 1/3 of the world's population will be facing a severe water shortage, with the majority of water scarcity occurring in the southern hemisphere, the upcoming World Water Forum will be an important opportunity to share with a variety of stakeholders the current challenges and the 'local actions' that are an important part of exploring innovative solutions to these concerns," said Dato Ir. Hj. Keizrul bin Abdullah, President of ICID.
Discussions in Beijing focused on topics such as meeting the food needs of over eight hundred million people by 2025 estimated to be underfed. Despite an apparent sufficiency in the world food production, inequity and the problem of malnutrition in Least Developed Countries persists with about 20% of the world's poor people starving or underfed.
"Global food production will have to be doubled to achieve satisfactory food security for all. We are at a crossroads, food shortages due to the lack of proper management of water resources pose a major challenge, 5 million children die annually from hunger and in economic terms, developing countries lose billions of dollars in lost productivity. At the global level the ability to produce food is not the problem, the challenge is the ability to get the food to those in need," said Dato Ir. Hj. Keizrul bin Abdullah, President of ICID.
The ICID meeting brought together experts from all over the world to focus on one of the most important uses and applications of water. The large pressures faced due to population growth, limited areas of arable and useable land and the demands of changing lifestyles and strain on resources, makes the applications of land and efficiency of water use crucial concerns for the future.
"Irrigation in the world today accounts for 70% of all fresh water withdrawals, which are used to irrigate 17% of all cropped land yielding 40% of the overall agricultural outputs worldwide. When we look to increase future food production, the answer lies in expansion of irrigated and drained lands where potential exists, and importantly, in existing irrigated and drained areas and an increase in water use efficiency and land productivity," said Aly Shady, President Honoraire of the International Commission on Drainage and Irrigation and President of the International Water Resources Association (IWRA).
"The 4th World Water Forum is an important event to build a bridge and platform for discussion on many of the issues that affect people and governments all over the world," said Madame Meng Zhimin, Deputy Director of the Department of International Cooperation Science and Technology, Ministry of Water Resources, PRC.
The overarching theme of the World Water Forum is Local Actions for a Global Challenge. A local action is defined as any activity or group of activities focused on solving a problem related to the management of water resources, the benefits of which are tangible at the local level. These could be structural or non-structural actions that have an impact on local administration of water. The main aim of a local action is to seek options for the sustainable development of a community or a region, without compromising the preservation of the local ecosystem.
"By sharing the experience from these local actions and recognizing the necessity of adapting unique approaches from across the globe to meet local community needs we are able to meet the challenges of water resource management and create projects that take into account multiple stakeholder and environmental concerns, providing a more integrated approach," said Dr. Luis Rendon, Chairman of the Mexican National Committee for the ICID.
Dr Rendon presented Mexican experiences and knowledge to the ICID conference as part of an international exchange of ideas and understanding.
About the 4th World Water Forum
The World Water Forum is an initiative of the World Water Council aiming at raising awareness on global water issues. The First Forum was held in Morocco (1997), the Second in The Hague (2000) and the Third in Japan (2003), the 4th World Water Forum will be held in Mexico City in March 2006, under the overarching theme of "Local Actions for a Global Challenge" with focus on best practices and knowledge sharing.
The Fora has already been established as an open, multi-stakeholder participatory process, which build on the knowledge, experience and input of the global water community and seeks to enable multi-stakeholder participation and dialogue to influence water policy-making at a global level, thus ensuring better living and respect for the principles of sustainable development to achieve the Millennium Development Goals. The World Water Fora are built on the knowledge and experience of different types of organizations active in the global water policy. It is a venture founded on the principles of collaboration, partnerships and innovation.
About ICID
The International Commission on Irrigation and Drainage (ICID) was established on 24 June 1950 as a Scientific, Technical and Voluntary Not-for-profit Non-Governmental International Organization (NGO) with headquarters in New Delhi, India. The Commission is dedicated to enhancing the worldwide supply of food and fiber for all people by improving water and land management and the productivity of irrigated and drained lands through appropriate management of water, environment and application of irrigation, drainage and flood management techniques.

GMOs can benefit the farmer, society and the environment
September 19, 2005
The Charlottetown Guardian
Eddy Dykerman, president of the P.E.I. Federation of Agriculture, writes regarding'Farmers divided on planting GM crops' (The Guardian, Sept. 15, 2005), to say that the Standing Committee on Agriculture, Forestry and Environment started hearing from presenters in February of this year on the issue of Genetically Modified Organisms (GMO) and their production on P.E.I.
We have listened with interest from many environmentalists who warn about the dangers of GMOs and urge farmers to reject this technology and go back to a simpler way of farming. While it may be nostalgic to consider going back to the small mixed farms of days past - this is unrealistic. Fewer farmers today are feeding a nation that is increasingly urban oriented. The technological advances that farmers are adopting are making our food supply safer and more abundant.
Environmental groups like Greenpeace have warned the legislative standing committee that GMO technology has yet to be proven safe for humans and the environment and that co-existence between organic, non-GMO and GMO crops is impossible. The fact of the matter is that despite the advent and growth of biotech crops in the last 10 years, organic acreage has also grown by leaps and bounds in Canada. All the facts point to co-existence working. GMOs undergo rigorous testing before being approved by the Canadian Food Inspection Agency and Health Canada. Independent scientific organizations, like the World Health Organization, have conducted extensive studies over the last 15 years into GMOs and have found no negative health impacts while noting that GMOs provide significant health and environmental benefits.
In terms of the environment, the benefits of GMO technology are clear. The growing of GMO crops generally result in a reduction of chemical inputs and allow the adoption of low and zero tillage systems. Most importantly, GMO technology allows more yield from less and less land. This allows for increased land-use efficiency and offers added benefits for biodiversity. The less land that is required to grow our food, the more that can be retained as forest and wilderness where biodiversity can flourish.
Environmentalists continue to invoke the so-called 'precautionary principle' as an argument for banning GMO technology. Does this mean that we stop learning and applying new technologies in society? No technology is infallible; however, we work to manage risks with the tools available to us at the time. Life is not without risks; if we only moved forward with 100 per cent certainty our society would be at a standstill.
The real question is whether the risks of pursuing genetic modification are greater or less than the risks of not pursuing it. To us the choice is clear - GMOs can be a benefit for farmers, society and the environment.
As stewards of the land, Island farmers have decades of experience working with our neighbours and living in harmony. With the proper management practices - buffer zones, segregating harvested crops, co-ordinating planting dates with neighbours - there is no issue in biotech, conventional and organic production methods being practised side by side.

Making plant cells work like miniature factories
September 16, 2005
Ames Laboratory
AMES - The biotech field of genomics gives scientists genetic roadmaps to link certain genes to diseases. The subsequent study of proteins produced by certain genes spawned the field of proteomics.
Now, a group of researchers at the U.S. Department of Energy�s Ames Laboratoryat Iowa State University will use $1.02 million in DOE start-up funding to begin understanding the chemical processes that take place within the cells of plants. This new field, called metabolomics, could result in harnessing plants to efficiently produce biomass for energy production, chemicals and materials for industry or pharmaceuticals, and untold thousands of other uses.
�We know a lot about the genetic make-up of many plants, but we know very little about the chemical changes that take place within plant cells that eventually produce sugars, fibers or waxes,� said Ed Yeung, program director of Chemical and Biological Sciences at Ames Lab and principal investigator on the project. �If we can understand metabolism, then ideally, all the materials a plant produces can be controlled.�
The project, �Mass Spectrometric Imaging of Plant Metabolites,� combines the analytical chemistry expertise of Ames Laboratory with the strength of ISU�s Plant Sciences Institute. Yeung, who is also a distinguished professor of chemistry at ISU, is internationally recognized for his work in developing separation and detection technologies, having won four R&D 100 awards.
Also working on the project are Sam Houk, an Ames Lab senior chemist who specializes in identifying trace elements using inductively couple plasma-mass spectrometry, and associate scientist and ISU chemistry professor Ethan Badman, who specializes in mass spectrometry and gas-phase methods of analysis for biological molecules. Rounding out the team is Basil Nikolau, Director of the Plant Sciences Institute�s Center for Designer Crops and a specialist in biochemistry and functional genomics of plant metabolism.
Funding from the Chemical Sciences, Geosciences and Biosciences Division of the DOE�s Office of Basic Energy Sciences provides $340,000 for operation and equipment this year and another $680,000 in 2006. Additional money is expected in 2007 and could continue if the program receives good marks during a peer review scheduled for 2008. Before they can study the chemical makeup within plant cells, the team must construct new analytical instruments capable of identifying molecules in such minute quantities.
�Developing the instrumentation is a large part of the proposal and we�re building a special, high-resolution mass spectrometer,� Yeung said, �because there�s nothing available commercially that meets our needs.� He added that the equipment will be housed in the Roy J. Carver Co-Laboratory on the ISU campus.
Mass spectrometry works by measuring the mass of individual ions � molecules that have been electrically charged. Plant material is ionized into a gas, sorted in an analyzer chamber according to the mass-to-charge ratios, and collected by an ion detector. The detector converts ion flux into a proportional electrical current. Finally, the magnitude of the electrical signals is recorded and plotted as a mass spectrum.
The ability to sort and detect these ions at cellular-scale quantities is where the team hopes to fine-tune the instrumentation.
Once the equipment is ready, the team will look at the chemical content in the cells of Arabidopsis thaliana, a small flowering plant that is widely used as a model organism in plant biology. Arabidopsis is a member of the mustard (Brassicaceae) family, which includes cultivated species such as cabbage and radish.
�Arabidopsis is not a major crop like corn and soybeans,� Yeung said, �but because so much is already known about it genetically, we can hopefully begin to draw correlations between the chemical and genetic makeup. We hope that such fundamental research will be applicable to other plants as well.�
Ames Laboratory is operated for the Department of Energy by Iowa State University . The Lab conducts research into various areas of national concern, including energy resources, high-speed computer design, environmental cleanup and restoration, and the synthesis and study of new materials.

Harmful Organisms - Third Country Imports - Inspection of Imported Products
September 19, 2005
European Commission, Health and Consumer Protection
The complete document of the following can be downloaded from:
http://europa.eu.int/comm/food/plant/organisms/imports/inspection_en.htm
List of products recommended for plant health checks at reduced levels (PDF) Updated

September 12 - September 19, 2005
Ohio State University C.O.R.N Newsletter 2005-30
Robert Mullen and Maurice Watson
http://corn.osu.edu/index.php?setissueID=103#E
As soybean harvest progresses, soil sampling probes should be getting shined up and readied for field activity. Soil sampling to determine soil nutrient status is one of the most economical management practices for crop production. Fall sampling should be done to determine the phosphorus, potassium, and soil pH status of soil. These values will be used to determine how much phosphorus (P), potassium (K), and lime should be applied this fall to prepare for next year�s crop. This is especially important as fertilizer prices have increased. If soil analysis reveals the soil contains more P and K than the subsequent crops need, money that was ear-marked for those fertilizer materials can be used elsewhere.
Soil analysis is only as good as the sample that was collected. Utilizing proper techniques to collect soil samples are extremely important and can have dramatic impact on the recommendation. Collect 15 to 20 random 8 inch soil samples from a representative area to create a composite sample. Do not collect less than 15 samples for each area being sampled. This will ensure the sample truly represents the area of interest. Analytical labs in and around Ohio can be found at the following website: http://agcrops.osu.edu/fertility/.
After receiving the analysis from the lab, go the Tri-State Fertilizer Recommendations online to determine the rate needed to maximize production (http://www.ces.purdue.edu/extmedia/AY/AY-9-32.pdf). Recommended rates of fertilization can also be found at: http://www.agry.purdue.edu/mmp/webcalc/fertRec.asp (this website is based on Tri-State Fertilizer Recommendations). If soil analysis reveals the soil is well above the established critical level, consider not applying that nutrient this fall. If below the critical level, the nutrient should be applied to ensure it is not yield limiting.
Soil sampling should be done at least every three years (if not on a shorter interval) to evaluate trends in soil nutrient status. Sampling the fall prior to spring corn planting is an excellent time to collect soil cores.

Fall and winter cover crops � can nitrogen be �trapped� for next year�s crop?
September 12 - September 19, 2005
Ohio State University C.O.R.N Newsletter 2005-30
Robert Mullen
http://corn.osu.edu/index.php?setissueID=103#E
Nitrogen prices have increased significantly over the last five years, and unfortunately it appears as if they will continue to increase at least slightly this coming year. The increased cost for this input has led many to find alternative ways to keep more nitrogen around including the use of fall cover crops to �trap� or �catch� nitrogen for subsequent crops. So does this practice work? Can spring corn N rates be decreased if utilizing fall cover crops in continuous corn production systems?
Research suggests that fall cover crops can help mitigate nitrogen loss from agricultural fields (specifically rye). Research conducted in Minnesota revealed a decrease in nitrate loss, measured at the tile discharge, of 13% when rye was planted as a cover crop after corn and prior to soybean. But this decrease in nitrogen loss in the fall does not necessarily translate into subsequent nitrogen release for next year�s crop.
Over 8 site-years in Washington State, use of a non-leguminous cover crop (rye or ryegrass) did not decrease the need for N fertilization with the exception of one year. Thus subsequent fertilizer rates could not be decreased for the next corn crop. Use of vetch as a cover crop did slightly decrease the amount of N needed to optimize yield. In this study all cover crops were planted in late September/early October and allowed to grow all spring until Late April. Data collected in Wisconsin show that in 2 out of 3 years the N rate for optimum production was decreased (approximately 18 lb per acre) if a cover crop (rye, oat, ore triticale) was grown on a sandy soil. The response observed in this study was attributed to a rotational effect rather N release the subsequent spring. This was hypothesized because the decrease in N fertilizer was observed with or without the above-ground biomass being present in the spring.
So why is there not a consistent decrease in the optimum N rate if N that is susceptible to fall/winter loss is captured? It all comes down to timing. Even though N is taken up by a growing plant in the fall does not necessarily mean that it will be released at the optimum time the next spring so that it is not susceptible to loss. If spring planting is delayed and soil conditions are warm enough for mineralization, early spring rains may move the N below the rooting zone down to the tile prior to crop emergence. Another reason is poor growth of the cover crop in the fall and winter. If the cover crop does not accumulate much biomass and subsequent N, intuitively there will be little N benefit for the next crop. Under certain conditions this practice may provide some benefit, but enough is not known to accurately quantify the benefit.

End of season cornstalk nitrate-n test
September 12 - September 19, 2005
Ohio State University C.O.R.N Newsletter 2005-30
Maurice Watson and Robert Mullen http://corn.osu.edu/index.php?setissueID=103#E
The cost of fertilizer nitrogen (N) has sky rocketed this year. Because of the dramatic increase in fertilizer and fuel costs, the end of this growing season is a good time to really examine your fertilizer nitrogen program for corn. Has your application of N routinely been over 200 lbs/a for the last several years? This may or may not have always been the best amount to apply. An �End of Season Cornstalk Nitrate-N Test� can provide some important information about your nitrogen application program.
What Is It and Why Is It Useful?
The cornstalk nitrate-N test determines the concentration of nitrate-N in the lower portion of the cornstalk near the end of the plant�s growth. Knowledge of the nitrate-N concentration in this part of the corn plant will provide information as to whether or not there was insufficient, adequate, or excessive amounts of nitrogen applied early on in the growing season. Corn plants that have inadequate N levels remove N from the lower part of the cornstalk and leaves during the grain-filling period. Research by A. M. Blackmer and A. P. Mallarino of Iowa State University has shown that corn plants that have more N than is needed to attain their maximum yield accumulate nitrate-N in the lower part of the cornstalk. This information can be used to determine if more N than was needed was present in the soil for the corn crop. The test can help reduce application of more N than is really needed year after year.
Dry weather can affect the results so know your soil moisture conditions during the corn growing period. It should be kept in mind that plants under severe droughty conditions may have greater nitrate-N concentrations than plants under normal growing conditions. Records of the test results and soil moisture observations should be kept and evaluated over several years in accordance with fertilizer management programs. Producers who are growing corn on manure amended soils should use the test. In addition, producers who are growing corn after alfalfa should use it as well. A very important use of the test is to make comparisons for different nitrogen management practices.
When and How To Take The Sample:
The sample should be taken 3 weeks after black layers have formed on about 80% of the kernels of most ears. The black layer is a thin black line at the tip of the corn kernel. The black layer coincides with physiological maturity. An 8-inch portion of the stalk 6-14 inches above the soil should be sampled. Remove leaf sheaths from the stalk. Fifteen 8-inch segments should be collected to from the sample to be submitted to the laboratory. Areas that differ in management or sample soil type should be sampled separately. The sample should be representative of corn growing in the area of interest. Place samples in paper bags (not plastic) and send them to the laboratory as soon as possible after collection.
Where To Send Samples:
Most soil testing laboratories also do the �End of Season Cornstalk Nitrate-N Test�. Be sure to contact the laboratory before collecting the samples as they may have special forms and bags for this type of test. Your local County Extension Educator can assist you in locating an appropriate laboratory.
Interpretive Guidelines for the Nitrate-N Concentrations:
250 ppm --- Low: Indicates a high probability that greater availability of N would have given a higher yield. Visual symptoms usually present.
250 � 700 ppm --- Marginal: Indicates that N availability was close to the amount needed by the crop.
702 � 2,000 ppm --- Optimal: Indicates a high probability that N availability was within the range needed for optimum yield.
2,000 ppm --- Excess: Indicates a high probability that N availability was greater than needed for optimum yield.
If the test shows 2,000 ppm year after year, you may want to reduce the amount of N applied for the next year�s crop. Dry weather can affect the results. Under conditions of severe drought, the plants may have greater amount of nitrate-N than plants under normal growing conditions. Be sure to take soil moisture into account when making the interpretation.

Nitrogen for corn in 2006
September 2, 2005
The Bulletin Number 22
University of Illinois Bulletin
Emerson Nafziger and Bob Hoeft
http://www.ipm.uiuc.edu/bulletin/article.php?id=410
Recent reports suggesting that nitrogen rate recommendations for corn in Illinois are inaccurate have created a great deal of confusion. This unfortunately is coming at a time when N prices are record-high, yields in some Illinois corn fields were reduced by drought in 2005, and corn prices have been held down by reports of higher supplies and some shipping problems.
We recognize that N rate recommendations have always tended to be a moving target, and that changes in hybrids and management have probably improved the efficiency of fertilizer N use. We applaud efforts to try to find ways to predict how much N the soil will supply to the crop each year; such an approach could help us to know better how much fertilizer N we need. We are not yet there, however. Thus statements like "Forget what you know about N", without a carefully-drawn and clear alternative, are without any merit whatsoever.
We fully recognize the limitations of the proven-yield method (N rate equals 1.2 times proven yield minus credits for soybean or other legume or manure), and that this method generally results in N rates that tend to be high for many fields. Having N at "almost always adequate, so sometimes excessive" rates has been the goal for most producers, given that N price has generally been low relative to the corn price. This method was based directly on data from field studies, which have tended to show that corn following corn responds to N up to the point when the N rate to yield ratio is about 1.1 to 1.2, depending on prices of N and corn. It was not simply pulled from the air, nor was it directly based on the amount of N found in a corn crop at a certain yield level.
Adjustments for soybean and other previous practices were based on direct comparison trials, in which we have found that corn following soybean responds less to N than corn following corn. Thus was born the "soybean N credit", which is an adjustment in the N rate to reflect the lower response to N fertilizer following soybean. Our most recent research confirms that the best N rate for corn following soybean is in fact about 40 lb of N per acre less than when corn follows corn. This difference might change when we have enough data to allow us to "decouple" N rates following soybean from those following corn, with separate recommendations for each. That will mean that adjustments for N "credits" won�t be needed, even though we know that corn following corn needs more N than if corn were following soybean in the same field.
Our newest approach has been to use the large amount of N response data generated by a number of recent and current research projects in Illinois to narrow in on what N rate is likely to produce the best return to N fertilizer in the field. To do this, we take the yield increase from N (above the yield without N) times the price of corn, and then subtract the cost of N (rate times price) at each N rate, ranging from zero to 200 lb or more. That produces a "return to N" (RTN) number, in dollars per acre, for each rate of N.
We have calculated the RTN for some 250 research trials, and then averaged these values over appropriate groups of data, for example, by geography or by general soil type. Using this approach allows us to calculate the range of N rates over which return to N is maximized. It is dynamic, in that we can adjust N rate guidelines based on prices of corn and N fertilizer. This approach depends heavily on having a lot of good data on corn response to N, and such data can only come from careful studies over a wide range of conditions. We will continue to carry out such studies in order to improve our confidence in the results. In the meantime, we think that current data provide reasonable guidelines for using N fertilizer on corn.
Using data from some 170 trials corn-following soybean conducted over the past decade in Illinois, we find that, with corn priced at $2.00 per bushel and N priced at 25 cents per lb, a rate of about 150 lb of N produces the maximum return to N (MRTN), with return being close to the maximum (within 1 dollar per acre) over the range of 130 to 175 lb of N. The average yield was 173 bu per acre over all trials at the MRTN (150 lb N per acre), which after the "soybean adjustment" makes for a ratio of about 1.1 lb N per bushel.
Among all of these trials, though, the best rate of N was NOT higher every time corn yield was high; there was no relationship between yield and the N rate required to reach that yield. How can this be? It can only be because the soil supplies widely variable amounts of N to the crop, due to factors such as soil organic matter content, soil depth, drainage, rooting depth, health of root systems, etc.. It is not unusual to see optimum N rates vary by 50 to 100 lb per acre over years when research trials are run annually in the same field. So far, it has been impossible to predict what the best N rate will be at the beginning of the season. Our approach thus acknowledges such variability, but at this point all we can do is to take an "average" approach to predict the N rate at which N will provide the greatest return. If and when we learn how to predict N fertilizer need before the season, we�ll be able to take a more exact approach.
If the corn price stays at $2.00 and N cost goes to 30, 35, or 40 cents per lb, the N rate providing the maximum return to N (MRTN) decreases, to 140, 130, and 122 lb N per acre, respectively, or about 2 lb less N for each 1-cent increase in the cost of a lb of N. The range over which return to N is relatively flat also shrinks at high N costs, to only about 35 lb (105 to 140 lb N per acre) when N costs 40 cents per lb. That means that the penalty for applying "safe" amounts�high enough to assure sufficient N under all conditions�increases as N gets more expensive.
For corn following corn, with a somewhat smaller database (some 80 site-years), our approach calculates maximum return to N at about 165 lb of N per acre, with a range of about 145-185 lb N, when corn is at $2.00 and N costs 25 cents per lb. As N cost rises, the rate at which N provides maximum return drops, again by about 2 lb N per acre for each 1-cent rise in N cost. When N costs 40 cents per lb, the rate expected to produce the highest return is only 137 lb per acre, and the suggested N rate range is 120 to 155 lb per acre.
Unlike the case when corn follows soybean, though, there is some tendency for corn following corn to need more N when yields are higher. This is likely because corn residue ties up some nitrogen, increasing the need for fertilizer N. It thus might be appropriate to adjust N rate within the suggested range, using higher amounts if there is reason to anticipate higher yields. We don't yet know what form this should take, but one possibility would be to take the N rate providing the maximum return to N and adjusting it up or down based on whether corn yield is expected to be higher or lower than average.
While we recognize the need to continue to improve nitrogen management, we think that N rates used by most producers are probably not too far from where they should be. One exception to this is in fields where corn follows soybean, and where proven yields, after the high yields of recent years, might be as high as 200 bu per acre. Using the proven-yield method, such yields call for N rates close to 200 lb per acre. Compared to the 140-lb rate that produces the maximum return with 30-cent N, applying 200 lb of N decreases profit by more than $6 per acre. When N costs 40 cents per lb, the loss in profit from applying 200 lb of N is more than $12 per acre. This doesn't count the cost of sending leftover N into our rivers. Such rates are simply higher than they should be.
So, while the proven-yield method has been mischaracterized as something it is not, it is clear that changes in hybrids and management in recent years have brought on the need to think again about N rates. Our best data tell us that N rates should be decreased in cases where rates are in the upper reaches of the current recommendations. For many, especially those who have moved to cut rates in recent years, the new approach is confirming that the economic consequences of such rate reductions may well be positive.
From our data, we know that there can occasionally be years when the N rate needed to maximize yield in a particular field can be as high as, or higher than, the highest rate recommended under the proven-yield method. There can also be years, even in the same field, when the N rate needed to maximize return to N can be much lower than even conservative methods might estimate. It helps to have an idea of how often to expect either of these extremes to occur, but we are far from being able to predict, and thus prevent, such occurrences. Until we can do so, we need to take an approach that averages a lot of response data together, in a way that allows up to understand how much N it takes to maximize return, and how much penalty there is for having rates too high or too low.
One final point: The recent attempt to discredit current N recommendations has included a contention, based only on the casual observations in very different fields, that high corn plant population require higher N rates. This was an attempt to explain why "higher than expected" N rates apparently were needed in some fields. The only way to test such a notion is to grow a corn hybrid at different populations and different N rates, all in the same field. We did this, and averaged over nine site-years, there was no difference in the optimum N rate among populations ranging from 25 to 40 thousand plants per acre. Others have shown the same results, and we know of no published information supporting the contention that high plant populations require higher N rates. Because the use of "high" plant populations has become known as a good management practice, the false belief that "high" populations need more N only encourages over-application of N.
When we acknowledge that optimum N rates are not related to yield level, we are also accepting the fact that other factors�soil, plant, or management�that might affect yield level may not necessarily affect N fertilizer need at the same time. Such connections may seem obvious, but they just don't operate consistently in the complex world of crops growing in fields with the weather we get. It is dangerous to use "common sense" to try to make such connections when the evidence shows clearly that the connection does not exist. This false contention lends support to the clearly erroneous notion that, because yield levels define N need, then surely N rate must limit yield levels, especially in fields that don't yield very well. It�s just not the way the world works, and to suggest otherwise is irresponsible.
For this fall, it should be business as usual for most Illinois producers in terms of N application, though some downward adjustments in rates are in order for some, based on our new approach. This includes waiting to apply until soil temperatures are 50 degrees or less (this usually means late October or early November), counting all forms of N, including that in DAP or MAP, and stabilizing fall-applied N to reduce N loss potential. For some, there may be difficult decisions due to price or form differences between fall and spring application. While we do not have the most convincing data to suggest that spring rates can be lowered from fall rates, much of our N response data were generated using spring applications, so they should be conservative if spring-applied N is occasionally used more efficiently than fall-applied N. Where corn in 2006 will follow corn that yielded less in 2005, some credit for unused N should be given.

#4139

From: Doug Powell <dpowell@...>
Date: Tue Sep 20, 2005 4:33 pm
Subject: Agnet Sept. 20/05

dpowell@...

how to subscribe

New blogs, new website at the Food Safety Network
Sept. 19/05
Food Safety Network
www.foodsafetynetwork.ca
barfblog.com and kitchenconfessional.com are just two of the new blogs to be hosted on the completely redesigned Food Safety Network website, launched today at the University of Guelph.
"We are continually trying to explore new ways to compel everyone in the farm-to-fork food safety system to take this stuff seriously," said Dr. Douglas Powell, scientific director of the Food Safety network and an associate professor in the department of plant agriculture at the University of Guelph. "Everyone I've met has their own personal greatest story of suffering through foodborne illness. We hope to capture these and inform others."
The World Health Organization estimates that between 1-in-3 and 1-in-4 people in developed countries suffer from foodborne illness each year.
"All the evidence suggests that current strategies to reduce the incidence of foodborne illness are just not working well enough," says Dr. Powell. "While there are many isolated success stories, and the food industry has made significant improvements in food safety, when I see a guy at a golf course order a hamburger, 'Bloody, with cheese,' we've failed those who matter most -- the consuming public."
Christian Battista, a research associate with the Food Safety Network, explains that barfblog.com is aimed at "Internet savvy users who enjoy grossout-type humor. Tell us your first or worst experience with food poisoning."
Ben Chapman, a PhD student with the Food Safety Network who is researching the effects of public restaurant inspection disclosure systems, says that kitchenconfessional.com is designed to collect the stories of those who have observed unsanitary practices in food service establishments, whether as a consumer or employee. "As a university student, we all have friends who have worked in food service and seen some questionable stuff," says Chapman. "By bringing those stories together, we hope to have a positive impact on raising food safety awareness. And have some fun."
The announcement came shortly after the Internet search engine Google announced a new search engine for blogs which is expected to help propel blogging into the cultural mainstream.
Dr. Sarah Wilson, a research associate with the Food Safety Network and manager of Canada's toll-free, bilingual, food safety hotline, says that the blogs are an additional tool to help raise awareness of food safety issues, in Canada and around the world, giving voice to frustrated consumers. "We get some very unusual phone calls and e-mails," said Dr. Wilson. "The level of food safety awareness is really quite low in Canada and anything that can increase that awareness is worth exploring."
The blogs are available at:
www.barfblog.com
www.kitchenconfessional.com
blog.foodsafetynetwork.ca
www.foodcontamination.ca
To learn more, visit www.foodsafetynetwork.ca
Contact:
Dr. Douglas Powell
associate professor
dept. of plant agriculture
University of Guelph
Guelph, Ont.
N1G 2W1
tel: 519-824-4120 x54280
cell: 519-835-3015
fax: 519-763-0478
dpowell@...
http://www.foodsafetynetwork.ca

Agnet Sept. 20/05

New blogs, new website at the Food Safety Network

EU farm ministers deadlocked over GMO maize approval

Council fails again to vote on biotech maize

Scientists study bee GM risk

Monsanto Company and Targeted Growth, Inc. announce commercial licensing deal for yield enhancement gene

French anti-globaliser Bove back in court for destroying GM crops

U.S. military buys tomatoes, lettuce from Davis, Calif., farm

P.E.I. spuds have flavour

Biotech conference-protests

AAFC: on-farm funding for climate change and water supply projects

$100 million in federal funding will transform the way land-use decisions are made in Canada

EU farm ministers deadlocked over GMO maize approval
Sept. 20/05
Reuters/AP
BRUSSELS -- Officials were cited as saying that EU agriculture ministers fell short of a required majority vote on Tuesday to authorise imports of a genetically modified (GMO) maize, again revealing their deep divisions over biotech foods.
The stories explain that the maize, known by its code number 1507, is jointly made by Pioneer Hi-Bred International, a subsidiary of DuPont Co., and Dow AgroSciences unit Mycogen Seeds. Their application is for import and processing for animal feed use.
The stories note that Denmark, usually a staunch opponent of GMO foods, changed its position and voted in favor of authorization but this was not enough to alter the balance between the EU-25's "pro" and "anti" GMO camps under the EU's weighted voting system

Council fails again to vote on biotech maize
Sept. 20/05
EuropaBio press release
Brussels -- Earlier today the EU Agriculture Council of Ministers was unable to reach agreement on the import and processing of 1507 maize (1), including animal feed use in the European Union.
The product is already approved in 12 other countries around the world and meets all the EU�s regulatory requirements, including three positive safety opinions from the European Food Safety Authority (EFSA) for all its intended uses in the EU.
While again some Member States have failed to vote according to the positive scientific opinion by EFSA, it is heartening to note that in Council more Member States voted positively for approving 1507 maize than when this dossier was reviewed by the Regulatory Committee in May this year.
�We hope that more Member States will recognise the benefits of GMOs for Europe�s agriculture, for the environment and for the Developing World and evaluate them scientifically on a case by case basis.� stated Simon Barber, Director of the Plant Biotechnology Unit at EuropaBio, the EU Association for bioindustries (3). �Denmark was one of the Member States responsible for the moratorium and by dropping its blanket opposition to GMOs, has demonstrated its support for EU regulations and of the benefits of GMOs.�
1507 maize is genetically modified with a Bt gene, making it resistant to certain insect pests and was jointly developed by Pioneer Hi-Bred International, Inc. and Dow AgroSciences.
(1) Updated fact sheet
http://www.europabio.org/articles/Background%20Briefing_maize1507_Update%20Sept%202005.doc
http://www.europabio.org

Scientists study bee GM risk
September 20, 2005
ABC
With canola flowering across much of Australia's grain belt, researchers are, according to this story, watching the activity of honeybees to determine whether bees could carry herbicide-resistant pollen, or genetically modified material to other canola crops.
Dr Janine Baker from the Cooperative Research Centre for Weed Management was cited as saying the research project stems from the global move towards GM crops and that results so far show it is a problem than can be managed, because bees do not move large distances and tend to work single varieties of canola, adding, "It's not a huge issue and it looks as though it's one that we can manage quite easily, because, as I said, they don't like to travel far. So if there are concerns about what's happening with bees, we can look at what sort of buffer zones we have to have in place and those sort of issues. So, in terms of management, it's a risk assessment and it's one we think we can manage quite easily."

Monsanto Company and Targeted Growth, Inc. announce commercial licensing deal for yield enhancement gene
September 20, 2005
From a press release
ST. LOUIS/SEATTLE - Monsanto Company and Targeted Growth, Inc. (TGI) today announced a licensing agreement for the development and commercialization of a yield enhancement gene that was developed by TGI.
The agreement includes exclusive licensing rights for one of TGI's demonstrated gene enhancing technologies in applicable Monsanto crops. TGI receives an upfront payment as well as milestone payments and a royalty rate structure. Additional financial terms were not disclosed.
"Yield increase is a main focus area for Monsanto, so we're excited about the possibilities that this gene could bring to our product offerings," said Robert Fraley, Ph.D., Monsanto's chief technology officer. "TGI's technology in yield research and discovery is a natural fit within our development pipeline, which translates new agricultural technology into products that benefit farmers."
TGI is a leading provider of technologies specifically focused on increasing crop yields. Through extensive basic biology and field trial research, the company has established that specific changes in the expression of a single gene in certain agricultural crops significantly increases yield.
"Increased yield is a key goal to improving agricultural crops and our technology consistently demonstrates percentages of yield increase in the double-digits in canola at both U.S. and Canadian test sites," said Thomas Todaro, chief operating officer of Targeted Growth. "We are pleased with the results and excited about the potential for increasing agricultural crop yields throughout the world."
Yields have been improved through traditional breeding and this technology has now proven that plant biotechnology can contribute to the yield increase in a very significant way.
"In practical terms, increasing yields through biotechnology will increase the efficiency of agriculture and allow farmers to be more productive," Todaro said. "Other possible implications include increased revenue to farmers and more availability of food producing crops for global consumption."
www.monsanto.com .
www.targetedgrowth.com .

French anti-globaliser Bove back in court for destroying GM crops
Sept. 20/05
Agence France Presse English
TOULOUSE, France -- French anti-globalisation activist Jose Bove was, according to this story, given an ovation by supporters Tuesday when he appeared with eight others at a court in the southern French city of Toulouse to stand trial for destroying genetically modified (GM) crops.
A smiling Bove, 52, who was imprisoned for five weeks in 2003 on similar charges, was quoted as telling reporters he was delighted to have the chance
to "alert public opinion about the dangers of GM farming."

U.S. military buys tomatoes, lettuce from Davis, Calif., farm
September 20, 2005
The Sacramento Bee, Calif.
Jim Wasserman,
Source: Knight Ridder/Tribune Business News
The U.S. military, which runs dining halls around the world, is, according to this story, spending nearly $3 million to fund a Davis firm's quest for longer-lasting tomatoes and heads of lettuce.
The story says that Arcadia Biosciences, a 3-year-old agricultural biotech firm, has won a $2.9 million Department of Defense contract to develop tomatoes and lettuce that can survive the rigors of long-distance sea shipping, and the hope is that the seed money will fund research and commercialization of the produce, which the military could then buy and ship around the world.
Patrick Dunne, biochemist at the Defense Department's Massachusetts-based Combat Feeding Directorate, was quoted as saying, "It's definitely a morale builder. We would like to have a guaranteed safe supply that could be shipped from a U.S. location and still get overseas around the globe in good condition."
Arcadia's goal is to have the new tomatoes on grocery store shelves by 2009 and heads of lettuce ready for sale by 2010.
The story adds that Arcadia aims to break through without the controversies attendant to genetic engineering. The start-up does plan to use genetic sleuthing to double the two-week shelf life of fresh lettuce and add 30 days to the normal three-week life of tomatoes.

P.E.I. spuds have flavour
September 20, 2005
The Charlottetown Guardian
Jean Sturgeon of Hebron, Connecticut writes regarding the controversy surrounding the planting of genetically modified potatoes on P.E.I. ('Farmers divided on planting GM crops', The Guardian, Sept. 14, 2005).
As a consumer, Sturgeon says that genetically modified food that has become all too prevalent in the U.S. Sturgeon adds that PEI potatoes tasted like the potatoes of our youth, meaning they actually had taste. Potatoes are not the only crop that has lost its flavour over the years. Tomatoes, apples, peaches, plums have all become casualties of a culture that wants unblemished and perfectly formed fruits and vegetables - fruits and vegetables that can be transported over great distances because they don't bruise easily, fruits and vegetables with long shelf lives. Genetically modified fruits and vegetables that are as hard as rocks never seem to ripen and have absolutely no taste.

Biotech conference-protests
September 20, 2005
Associated Press
PHILADELPHIA�A man accused of triggering a skirmish with police at a biotech protest, during which an officer died of a heart attack, was, according to this story, ordered Monday to stand trial on charges of aggravated assault.
Assistant District Attorney Michael Barry was cited as arguing that Guillaume Beaulieu, 23, of Quebec, intended to start a brawl by dumping water on an officer during a June 21 protest at the convention of the Biotechnology Industry Organization.
Another officer who was on the fringe of the ensuing scuffle collapsed of a heart attack and later died.

AAFC: on-farm funding for climate change and water supply projects
Sept. 20/05
From a press release
LISTOWEL, ONTARIO-- Ontario farm and agribusiness operators now have access to over $20 million in their ongoing efforts to care for the health of the environment and reduce greenhouse gas emissions. The Greencover Canada Program will support projects that enhance biodiversity, prevent wind and water erosion of precious farmland and improve the quality of surface water and
groundwater. The Canada-Ontario Water Supply Expansion Program (COWSEP)
will help Ontario producers develop, conserve and enhance sustainable
water supplies.
"The Greencover Canada and Water Supply Expansion programs support the
agriculture industry in its longstanding tradition of carefully managing
the environment," says Minister Mitchell. "Canadian producers are
dedicated to sound environmental practices, and the Government of Canada
is pleased to provide strong programs to assist them."
Under Greencover Canada, the Government of Canada will contribute $15
million in financial and technical assistance to help producers improve
water quality in streams, rivers and lakes, adopt sustainable land use
practices, reduce greenhouse gas emissions and enhance fish and wildlife
habitat.
Producers who have completed an Environmental Farm Plan and identified an
eligible project under one of Greencover's Beneficial Management Practices
(BMPs) categories may qualify for up to $20,000 in cost-shared funding to
help implement their project. Projects such as establishing buffer strips
of permanent vegetation along streams and rivers and fencing to limit
livestock access to watercourses will be eligible.
Through COWSEP, the Government of Canada will provide $5.6 million in
technical and financial assistance. Primary producers, agricultural and
conservation groups, rural communities and municipalities, agribusinesses
and rural enterprises, educational institutions and provincial government
agencies and Crown corporations are eligible for COWSEP assistance.
Under COWSEP, three types of projects will be eligible for assistance:
Tier 1 - on-farm water projects; Tier 2 - multi-user water supplies; and
Tier 3 - strategic initiatives. The Government of Canada will allocate up
to $2.2 million for each of the on-farm and multi-user programs, and up to
$1.2 million for strategic initiatives. The provincial government will
match the federal government's contribution towards multi-user projects
over the lifetime of the program.
"The Greencover and Water Supply programs, along with the Environmental
Farm Plan and Canada-Ontario Farm Stewardship Programs, are important
tools to help Ontario producers protect our water," says Minister
Dombrowsky. "We are listening to suggestions from the agriculture
community, and we will continue working with the federal government and
with the industry to design programs that enhance the health of Ontarians
and their environment."
In Ontario, the Greencover Canada Program and the $2.2 million on-farm
portion of the COWSEP program (Tier 1) will be delivered by the Ontario
Soil and Crop Improvement Association (OSCIA) in partnership with the
federal and provincial agriculture departments. The OSCIA is also the
program delivery agent for the federal government's $57 million
Canada-Ontario Farm Stewardship Program and Environmental Farm Plan
programs, which were announced April 16, 2005 and the province's $20
million Nutrient Management Financial Assistance Program.
"We have worked very hard with our government partners and other farm
organizations to provide producers with one-window access for on-farm
environmental funding programs," says Kevin Ferguson, president of OSCIA.
"Although each of these programs is delivered through different government
agreements, the application and administration process will appear
seamless to the Ontario farm community."
The Agricultural Adaptation Council (AAC) will deliver Tiers 2 and 3 of
the COWSEP Program.
"Ontario has a great opportunity to realize tangible environmental
benefits through COWSEP," says Bob Bedggood, AAC Chair. "Now more than
ever, we need to encourage the adoption of sustainable methods for
developing and protecting water resources in the rural and agricultural
regions of Ontario, and this program will support just that."
Information on the Nutrient Management Financial Assistance Program and
application forms for the Greencover Canada, Canada-Ontario Farm
Stewardship and the Environmental Farm Plan programs will soon be
available from OSCIA at 1 800 265-9751 or visit
www.ontariosoilcrop.org/EFP/EFP.htm
BACKGROUNDER
Greencover Canada Program in Ontario
Greencover Canada is a five-year, $110-million dollar Government of
Canada program which provides producers with technical and financial
assistance to implement land-use-related farming practices that offer both
environmental and economic benefits.
Through its four program components -- Land Conversion, Critical Areas,
Technical Assistance, and Shelterbelts -- Greencover contributes to the
improvement of grassland-management practices, supports sustainable land
use, protects water quality, reduces greenhouse-gas emissions, enhances
biodiversity and wildlife habitat, and promotes expansion of the national
land base covered by perennial forage and trees.
In Ontario, $15 million has been allocated under Greencover Canada until
April 1, 2008. The Greencover Canada Program will be administered and
delivered by the Ontario Soil and Crop Improvement Association (OSCIA) in
partnership with Agriculture and Agri-Food Canada (AAFC) and the Ontario
Ministry of Agriculture, Food and Rural Affairs (OMAFRA).
Greencover Canada Components
- Under the federally-delivered Land Conversion Component,
producers can apply for financial incentives to convert
environmentally sensitive annual cropland to perennial cover
- The goal of the Technical Assistance Component is to accelerate
the adoption of beneficial management practices (BMPs) for the
sustainable use and management of pastures, hay land and
riparian areas
- Under the Critical Areas Component, producers can apply for
financial assistance to help protect water quality by enhancing
riparian areas
- Under the Shelterbelts Component, producers can apply for
financial assistance to plant trees on agricultural land to
protect and preserve soil and water resources, enhance crop
production, provide wildlife habitat and capture atmospheric
carbon.
Greencover Canada Objectives
- Increase buffer corridors along watercourses
- Protect shallow groundwater systems in riparian areas
- Control stream bank erosion and enhance aquatic habitat
- Protect wetlands and environmentally sensitive areas and
habitats
- Protect existing water supplies (quality and quantity)
- Reduce wind erosion, as well as building and livestock energy
lost through strategic planting of tree windbreaks and
shelterbelts
- Enhance species diversity on the agricultural landscape
- Reduce greenhouse gases through the sequestration of carbon
dioxide
- Offer cost-share assistance to assist farmers with related
project planning and establishment costs
Relationship to Canada-Ontario Farm Stewardship Program and Environmental
Farm Plan
Greencover Canada is an environmental initiative under the Agricultural
Policy Framework (APF). With the exception of those participating
exclusively in the Land Conversion component, an Environmental Farm Plan
(EFP) must be completed and deemed appropriate through peer review in
order to access any cost-shared funding through Greencover Canada.
Under Greencover, farmers may qualify for up to $20,000 in federal
funding based on a 50:50 cost-share arrangement on eligible planning,
material and establishment costs. Projects must be undertaken in one of
five specific beneficial management practices (BMP) categories:
- Riparian area management
- Erosion control structures (riparian)
- Shelterbelt establishment
- Consultative services for grazing management planning
- Consultative services for riparian health assessment
The OSCIA is the program delivery agent for Greencover, Canada-Ontario
Farm Stewardship Program/Environmental Farm Plan, the on-farm portion of
the Canada-Ontario Water Supply Expansion Program and the provincial
Nutrient Management Financial Assistance Program (NMFAP).
Although these are separate cost-shared programs delivered through
different agreements, the application and administration process will
appear seamless to the Ontario farm community.
BACKGROUNDER
Canada-Ontario Water Supply Expansion Program (COWSEP)
The Canada-Ontario Water Supply Expansion Program (COWSEP) is the Ontario
portion of the National Water Supply Expansion Program (NWSEP). The NWSEP
is a $60-million program administered by the Government of Canada, in
partnership with provincial governments, to help the agriculture community
develop and enhance agricultural water supplies.
The NWSEP is not covered by the APF implementation agreements signed by
the federal and provincial departments of agriculture because the
provincial departments of agriculture seldom have sole jurisdiction over
water development. COWSEP will provide $5.6 million in federal funding, in
partnership with the Government of Ontario, to cost-share agricultural
water supply related projects. The program will run until March 31, 2008.
COWSEP Eligibility
To be eligible, projects must have an agricultural water supply
component. Eligible applicants for COWSEP assistance include individual
and/or incorporated groups of farmers, conservation groups, rural
communities and municipalities, agri-businesses and rural enterprises, and
educational institutions. Non-agricultural applicants must include
agricultural partners in the project.
Three types of projects are eligible for assistance under the COWSEP.
BMPs funded through the Canada-Ontario Farm Stewardship Program (COFSP)
are not eligible for COWSEP funds:
- (Tier 1) On-farm Infrastructure - Up to $2.2 million for
individual on-farm infrastructure (e.g. water wells, off stream
storage, etc.) that provide secure, safe and reliable water
supplies for agricultural producers. Approved on-farm
infrastructure projects are eligible for a one-third cost share
from COWSEP to a maximum of $5,000. Tier 1 will be administered
and delivered by the Ontario Soil and Crop Improvement
Association.
- (Tier 2) Multi-user Infrastructure - Up to $2.2 million for
larger scale infrastructure projects (e.g. regional irrigation
infrastructure) that supply a number of water users and provide
a long-term water source. Approved multi-user infrastructure
projects are eligible for a one-third cost share from COWSEP to
a maximum of $2,000,000. Tier 2 will be administered and
delivered by the Agricultural Adaptation Council.
- (Tier 3) Strategic Work - Up to $1.2 million for projects that
expand the knowledge base of the resource (e.g. regional
groundwater/surface water studies, groundwater exploration and
drilling, feasibility studies and information extension
activities), including support for agricultural water
management related organizations and activities. Approved
multi-user projects are eligible for a 75% cost-share from
COWSEP to a maximum of $500,000. Tier 3 will be administered
and delivered by the Agricultural Adaptation Council.

$100 million in federal funding will transform the way land-use decisions are made in Canada
Sept. 20/05
From a press release
LISTOWEL, ONTARIO -- Agriculture and Agri-Food Minister Andy Mitchell today announced the federal government is investing $100 million in the development of an Internet-based service that will provide a recognized source of information, analysis and interpretation of land, soil, water, climatic
and biodiversity data to assist land-use managers in their agri-environmental planning.
Led by Agriculture and Agri-Food Canada in partnership with other federal
departments, provincial, territorial and municipal governments,
non-government organizations (NGOs) and industry groups, the National Land
and Water Information Service will provide online access to current, local
and regional agri-environmental information such as the kind of production
a particular section of land will support.
"The Service is an investment in agri-environmental sustainability and
will serve the agricultural sector and all Canadians by encouraging
responsible land-use choices," said Minister Mitchell. "It will transform
the way these decisions are made in Canada."
Currently, the information needed to make responsible agri-environmental
decisions is either not available or is not easily accessible. The
National Land and Water Information Service will make data accessible
through a recognized point of entry using on-line technology and tools and
will also provide access to experts to help facilitate informed decisions.
Using the Service, agricultural producers will be able to determine, for
instance, if their land will support an expanded operation or whether the
water supply might be affected by the kind and size of the proposed
production.
"Through this Service, Agriculture and Agri-Food Canada will provide
information and decision support that encourages responsible environmental
choices," said Minister Mitchell. "Land management decisions at national,
regional and local levels require this range of support to ensure due
consideration of social, economic and environmental objectives."
The National Land and Water Information Service is an integral part of
the deliverables under the Agricultural Policy Framework (APF) to achieve
environmental goals. The APF is the comprehensive policy involving the
Government of Canada, provincial and territorial governments, and the
agriculture and agri-food industry. The goal of the APF is to help the
agricultural sector address emerging challenges, such as increasing
domestic and foreign consumer demand, increased global competition, and
advances in science.
The National Land and Water Information Service will be developed using
proven Geographic Information System (GIS) technology. GIS is a system of
computer software, hardware, data and personnel, which manipulates,
analyzes and presents information that is tied to a spatial location.
The Service is scheduled to be introduced through a phased approach over
four years.
BACKGROUNDER
National Land and Water Information Service
Canada's agriculture and agri-food industry is undergoing rapid change.
Global competition, trade challenges and public expectations are
accelerating the need to better use Canada's resources. The public and
private sectors have had to respond to changing demographics, greater
public concern about the health and safety of food and water, a growing
demand for new products, and concerns about environmentally sustainable
food production.
Trends toward more intensive agricultural practices and competing land
uses have resulted in higher demands on land, soil and water and air
resources, and have impacted climate and biodiversity as well. Proper
planning of agricultural development has become essential so that Canadian
land-use managers can maximize economic benefits while safeguarding the
environment.
The National Land and Water Information Service will be a coordinated,
national service providing easy and timely access to detailed geospatial
information and interpretive models to support local and regional land-use
decision making. It will leverage existing capability, scientific
knowledge, information expertise, and technological capacity,
strategically linking the land, soil, water, climatic and biodiversity
information of federal, provincial, territorial and municipal governments,
non-government organizations and the private sector. This partnership
among the owners of the information is the foundation upon which the
Service will be built.
Through the National Land and Water Service, land managers, community
groups, the agricultural sector, all levels of government and the general
public will be able to access meaningful geospatial information across
Canada.
It will assist the agriculture sector in developing a knowledge economy
by providing access to innovative applications, the best available
information and the capacity to use them. By encouraging efficient and
effective use and management of agricultural resources, Canada's national
competitiveness in the agricultural business will be strengthened.
The Service will provide:
- Expertise that includes knowledge management, the capacity to
interpret the information and to collect and maintain it;
- Partnerships with other governments, industries and farm groups
that have a need for agri-environmental information;
- Information Management/Information Technology infrastructure made
up of independent computers and databases housed not only at AAFC
but also at its many partner agencies;
- Applications that meet user needs to support decisions; and
- Data that is current, accurate and at an appropriate scale.
The objectives of the project are:
- To provide access to high quality, digital geographic information
that allows public and private land-use decision makers to manage
their business risk, increase the public awareness of these
decisions, and improve environmental sustainability;
- To develop and maintain relevant scientific and technical expertise
needed to extend the use of agri-environmental information;
- To lever and manage geospatial data sponsored by federal,
provincial and territorial governments, and to better utilize
planning capabilities;
- To improve data collection and policy development methods of all
levels of government; and
- To support and extend the capacity of environmental programs under
the Agriculture Policy Framework (APF), and interact with the other
elements of the APF.
The potential of the Service
Several projects demonstrate the potential of information products
that can be provided through the National Land and Water Information
Service. These include:
- Plant Hardiness Zone Maps for Canada, an Agriculture and Agri-Food
Canada initiative, outlines the different zones in Canada where
various types of trees, shrubs and flowers will most likely
survive.
http://sis.agr.gc.ca/cansis/nsdb/climate/hardiness/intro.html.
- AAFC, in partnership with the Manitoba Riparian Health Council
which includes representatives of the federal government, the
Manitoba provincial government, non-government organizations and
producer groups, developed a map viewing website with calculators
and tools to help landowners make decisions on how best to manage
and protect riparian areas and adjacent lands.
www.Riparianhealth.ca
- The Crop Condition Assessment Program (CCAP), developed and
maintained by Statistics Canada in partnership with Agriculture and
Agri-Food Canada, is an interactive product that uses low-
resolution, digital satellite data during the growing season to
monitor changing vegetation conditions in Western Canada and the
United States. http://www25.statcan.ca:8081/ccap/ccaphome.jsp
Implementation will be divided into four separate, distinct and
manageable phases, each of which provides increasing levels of
service and benefits for users. The project will be completed in
2009.
WWW.agr.gc.ca/NLWIS

#4140

From: Doug Powell <dpowell@...>
Date: Wed Sep 21, 2005 11:09 pm
Subject: Agnet Sept. 21/05

dpowell@...

how to subscribe

New crops that could help prevent famine launched
September 21, 2005
Reuters
George Obulutsa
NAIROBI - The India-based International Crops Research Institute for the Semi-Arid Tropics (ICRISAT) on Wednesday was cited as launching newly developed fast-maturing and drought-resistant crops it said could help prevent the type of food shortages experienced in West and Central Africa, and that the new varieties of "pearl millet" and "pigeon pea" crops were now available for use by poor farmers in semi-arid areas.
ICRISAT's West Africa director Saidou Koala was quoted as telling a news conference in Nairobi during the crops' launch that, "The famine in West Africa could have been averted or could have been reduced significantly with the use of science and technology. We, from ICRISAT, have developed millet varieties that, if they were used, would have contributed to offset the negative effects that we have seen on television."
Niger, Mauritania, Burkina Faso and Mali have all been suffering food shortages this year, with images of malnourished and starving children again shocking the world.

Agnet Sept. 21/05

New crops that could help prevent famine launched

To ensure safety, genetically modified organisms and food will be regulated

BioteCanada presents new poll results on Canadian attitudes toward biotechnology

Philippine agri dep't rationalizes biotechnology activities

GM food avoidance policies to become more expensive, according to new report

The present state of future food

Citrus canker - Australia (Queensland)(06)

Florida citrus canker eradication fighters out of money

Soybeans leading crop on Halton-area farms

Vineyard weeds found to host Pierce�s disease of grapes

UCR biochemist goes to Washington with high-protein corn

Cornell tapped for regional Sun Grant hub to use $8 million in U.S. funds to spearhead next green revolution

To ensure safety, genetically modified organisms and food will be regulated
September 20, 2005
Asian Tribune
Q. Perera
http://www.asiantribune.com/
COLOMBO - The Ministry of Environment and Natural Resources has established the National Bio-safety Framework for Sri Lanka (NBFSL) to regulate and control the importation of Genetically Modified Organisms (GMO) and food (GMF), as well as genetically modified feed and processed products into Sri Lanka.
Prof Athula Perera, University of Peradniya, National Project Coordinator, and National Bio-safety Framework Development Project has taken part in the preparation of these regulations and other deliberations.
GMO and GMF are being produced by the use of the modern recombinant DNA technology (genetic engineering/gene technology), where genes are identified, separated from one organism and transferred to the genetic system of another organism which is often from different species. This gene will produce a new protein in the organism which it never had earlier in its natural state. Such organisms are referred to as Genetically Modified Organisms (GMO) and any food obtained from such organisms are known as Genetically Modified Food (GMF).

BioteCanada presents new poll results on Canadian attitudes toward biotechnology
September 20, 2005
From a press release
OTTAWA - During the launch event of the 2nd Annual National Biotech Week in Toronto, Ontario, BIOTECanada will release the results of a recent national poll asking Canadians what they think of biotechnology and what their understanding is of the benefits of biotechnology.
A polling result snapshot indicates that Canadians support the industry. The majority of Canadians believe they will benefit from the biotechnology industry at some point in their lives, and those with a higher education are more likely to support the biotechnology industry.
A leading industry expert panel will provide a report card on our leadership potential for biotechnology and discuss Canada's emerging role in the international biotech community. Canadian scientists are global leaders in a significant number of research areas, but what can industry and governments do to strengthen Canada's ability to compete globally? What is the global environment for biotechnology and what is Canada's future role in it? Find out the answer to these questions and more during the launch event at the MaRS Centre in downtown Toronto.
National Biotechnology Week runs from Sept. 26-30 with a series of events and announcements across the country.
Visit www.imagenenation.ca for more event details.
What: National Biotechnology Week Launch Luncheon
Who: Pollster, Robert Daniel, BIOTECanada officials and industry
Panelists: David Crane, Business Columnist, The Toronto Star; Brian Harling, Vice President, Corporate Affairs Government Relations, MDS Inc.; Gregory Hines, President, CEO and Director, TM Bioscience; Dr. C.S. Prakash, Professor in Plant Molecular Genetics and Director of the Center for Plant Biotechnology Research at Tuskegee University, Alabama; and Dr. Peter Singer, Professor of Medicine, University of Toronto, Joint Centre for Bioethics
When: 11:30 am - 1:30 pm EST
Where: MaRS Centre, South Tower, Suite 100, 101 College Street, Toronto
Accredited media only.

Philippine agri dep't rationalizes biotechnology activities
September 20, 2005
Asia Pulse News
http://www.asiapulse.com/
MANILA - The Philippine Department of Agriculture (DA) is rationalizing its biotechnology-related activities to enhance the performance of the country's agriculture.
This will also maximize the use of available resources to develop new technologies.
The Philippine Rice Research Institute (PhilRice) will build a biotechnology centre at its Central Experiment Station in the Science City of Muoz, Nueva Ecija to serve as focal point where DA can unify and prioritize its existing biotechnology-related research.

GM food avoidance policies to become more expensive, according to new report
September 21, 2005
PG Economics
Delivering and maintaining non GM policies in the EU food and feed sector is set to become more challenging in the coming year. This is according to new research on the global GM market by three leading European agricultural and food experts[1]. The report, entitled "The Global GM Market: Implications for the European Food Chain. An analysis of labelling requirements, market dynamics and cost implications", identifies numerous food and feed ingredients in the food chain derived using genetic modification. It also concludes that the availability of non GM soybeans derivatives from Brazil (the largest supplier) is likely to decline in the next 12 months, resulting in an increase in the price differential between non GM and GM soy -possibly reaching as much as 25%[2]
For livestock product producers (producing meat, milk and dairy products), this widening price differential, for a primary feed ingredient, could result in feed costs rising by between 6% and 10% in the next 1-3 years, and lead to a decrease in profitability of between 9%-29%.This level of loss is likely to be unsustainable.
For manufacturers of products such as cooking oils and margarines, their switch away from using GM derived ingredients has also been adding significantly (over 16%) to raw material costs.This level of additional cost is also set to continue for the next 1-3 years.
The report suggests that these additional costs and feasibility problems (currently largely absorbed by the supply chain), may be unsustainable and may cause many businesses to re-think their GM-avoidance policies.
This is the first time that a serious attempt has been made to quantify the economic impact and feasibility of GM-avoidance policies. Many European food businesses which have chosen to apply these policies to their products are likely to be unaware of the extent to which many common food and feed ingredients are obtained from GMOs. These businesses should find the report thought provoking; according to Graham Brookes, one of the co-authors of the report.
Ends�A full copy of the report can be accessed on : www.pgeconomics.co.uk http://www.pgeconomics.co.uk

The present state of future food
September 21, 2005
The Hamilton Spectator
Rebecca Field Jager
Imagine a peanut with the allergen removed so everyone can eat it. Imagine rice enhanced with beta carotene so it fights blindness.
And what if bananas hosted a vaccine that prevented disease?
Thanks to advances in biotechnology, these products are, according to this story, probably less than a decade away.
To some, the subject of biotech food is a dicey one.
It's one thing to turn crops into non-food materials that imitate wood or plastic (already a reality, as you read on The Spec's front page Monday), but it's another to mess around with food.
But what if that food has a longer shelf-life, provides improved nutrition and taste, is of higher quality and more convenient and, most significantly, helps treat and fight disease?
Lois Ferguson, a dietitian and spokesperson for the Council for Biotechnology Information, was quoted as saying, "People are fearful because they don't understand the science. And they don't realize that it is very strictly regulated through the Canada Food Inspection Agency and Health Canada."

Citrus canker - Australia (Queensland)(06)
September 19, 2005
A ProMED-mail post
ProMED-mail is a program of the International Society for Infectious Diseases
http://www.isid.org
Sponsored in part by Elsevier, publisher of
The Lancet Infectious Diseases
http://infection.thelancet.com
Date: 19 Sep 2005
From: ProMED-mail ABCNewsOnline, 19 Sep 2005 [edited]
Citrus canker eradication program enters final stage
The Department of Primary Industries says only a few people still have concerns about the Government's citrus canker [CC] eradication program in central Queensland. By the end of the program, there will be no citrus trees left in the Emerald area.
Over the next few weeks 100 000 commercial trees, 4500 backyard trees and 2700 hectares of native citrus will be destroyed in the final phase of the eradication process.
2 Emerald citrus growers have won a $2.3 million [USD 1.77 million] contract to remove the commercial trees. According to Chris Adriaansan, The Department of Primary Industries' says destruction should move quickly despite a 1 week delay. As a consequence of CC, the citrus industry has been crippled on the central highlands.
The state and Federal Governments are contributing $4.6 million each to an $11.5 million package to help growers, with the remaining money to come from industry and the local community.
ProMED-mail
promed@...
[This appears to be the end of the road for the Emerald operation. A Senate inquiry into the outbreak has already been told that the owner of Evergreen Farms, where the disease was first detected, was allegedly illegally importing plant cuttings from overseas. There are also questions about how authorities handled the matter. It seems that no one can provide definitive information on the source of the citrus canker outbreak.

Florida citrus canker eradication fighters out of money
September 20, 2005
Knight Ridder/Tribune Business News
Kevin Bouffard, The Ledger, Lakeland, Fla.
LAKE ALFRED�The Citrus Canker Eradication Program may, according to this story, have to close its doors Oct. 1, unless the federal government or the Legislature comes up with more money.
Craig Meyer, the Florida deputy commissioner of agriculture and a co-chairman of the Citrus Canker Technical Advisory Task Force, which met Monday in Lake Alfred, was quoted as saying, "We are on the verge of being out of the canker eradication business."
Mac Turner, an Arcadia grower who has lost more than 1,400 grove acres to the eradication program, was quoted as saying, "At what point in the whole program do we say this has got to stop. The canker eradication program is going to eradicate the citrus industry in Florida."
Turner told The Ledger his frustration stems in large measure from the uncertainty over whether the federal government will compensate his family's grove business for the loss of some of that acreage.
Turner is one of the growers who have filed 337 compensation claims totaling $450 million with the U.S. Department of Agriculture.

Soybeans leading crop on Halton-area farms
September 20, 2005
Metroland - Halton Division
Bill Allison, director and past chair of the Ontario Soybean Growers, was quoted as telling members of the Halton Agricultural Advisory Committee during its 25th annual Halton Farm Tour Thursday that, "There's a great opportunity to build a future in bioproducts with soybeans. From cooking oil to carseats, we can do with soy the same as petrochemicals do for everday items."
The story says that considering Ontario produces 80 per cent of the soy grown nationally, it bodes well for the province's and region's future agricultural economy. One-third of the soy grown in Canada is exported.

Vineyard weeds found to host Pierce�s disease of grapes
September 21, 2005
The American Phytopathological Society
St. Paul, Minn. � New research just released in the September issue of Plant Disease suggests that weeds commonly found in California�s wine country may enable the spread of Pierce�s disease of grapes, one of the most destructive plant diseases affecting grapes.
Pierce�s disease is caused by Xylella fastidiosa, a bacterium transmitted by sharpshooters and spittlebugs. In response to outbreaks of Pierce�s disease in central California, plant pathologists studied 29 weed species commonly found in California�s San Joaquin Valley to see if the bacterium could survive on the weeds. Perennials and known feeding and breeding hosts of the glassy-winged sharpshooter were tested first, then plants particularly abundant in or near vineyards.
�Our objectives were to determine the fate of Pierce�s disease infections in previously untested plant species associated with southern San Joaquin Valley vineyards, and compare survival of the infections in selected field and greenhouse-grown plants,� said Christina Wistrom, staff research associate in the Department of Environmental Science, Policy and Management, University of California, Berkeley, CA.
The study revealed that environmental conditions have a major impact on bacterial growth in host plants. �Multiplication and systemic movement of X. fastidiosa varied among different plant species and environmental conditions, so weed species in vineyards must be evaluated on an individual basis to determine their potential contribution to Pierce�s disease,� Wistrom said. �Currently, Pierce�s disease is controlled by reducing populations of the insect vector, either through insecticide sprays or habitat modification to remove insect breeding host plants. Our study reinforces the need for weed control in irrigation ditches and roadsides adjacent to vineyards, in regions with chronic Pierce�s disease and established populations of sharpshooters, especially in warm weather,� she said.
The researchers recovered X. fastidiosa from 27 of 29 species in greenhouse tests. Sunflower, cocklebur, annual bur-sage, morning glory, horseweed, sacred datura, poison hemlock, and fava bean were most frequently infected. �Our study confirmed that plant species cannot be simply classified as either �hosts� or �nonhosts� of X. fastidiosa, but vary considerably among plant species in supporting growth and movement of the bacterium,� Wistrom said. In addition, she noted that the joint lab and field experiments showed that environmental conditions strongly influenced how rapidly the bacteria multiplied within the plants.
A full article is available in the September 2005 issue of Plant Disease. Published by The American Phytopathological Society (APS), Plant Disease is a leading international journal of applied plant pathology. APS is a non-profit, professional scientific organization. The research of the organization�s 5,000 worldwide members advances the understanding of the science of plant pathology and its application to plant health.

UCR biochemist goes to Washington with high-protein corn
September 21, 2005
University of California, Riverside
Corn with twice its usual content of protein and oil and about half of its usual carbohydrate content is what Daniel Gallie, professor of biochemistry at UC Riverside, will present at a congressional seminar in Washington, D.C., this week.
Because his research holds promise for efficiently feeding high-protein corn to people and livestock all over the world, Gallie has been invited to speak to an audience of congressional staff in the Longworth House Office Building of the U.S. House of Representatives. His 45-minute presentation is scheduled for 10 a.m., Sept. 23.
The National Coalition for Food and Agricultural Research, a broad-based coalition of agricultural producers, science societies and universities, is sponsoring the seminar.
In the United States, the vast majority of corn � nearly 65 percent � is used to feed animals for meat production. Much of the remainder is exported to other countries for feeding animals or made into corn sweeteners or fuel alcohol. Corn, the most widely produced feed grain in the United States, accounts for more than 90 percent of total value and production of feed grains in the country, with around 80 million acres of land planted with corn.
Gallie�s research on doubling the protein content of corn grain adds significant value to the crop, benefiting corn producers. Moreover, his technology nearly doubles corn oil, the most valuable content of corn grain, and significantly increases the grain�s value. Corn is processed also into other food and industrial products such as starch, sweeteners, beverage and industrial alcohol, and fuel ethanol.
�Nearly 800 million people in the world suffer from protein-energy malnutrition, which is a leading cause of death in children in developing countries, many of which already produce corn as a major cereal crop,� said Gallie. �A significant fraction of the world�s population, particularly in developing countries, has no access to meat as a protein source, and has to rely on plant sources such as grain. The new corn we have developed has two embryos in its kernel, which is what doubles the content of protein and oil and reduces the starch content. It could provide a good source of protein for those that depend on grain as their primary source of nutrients.�
Every corn kernel results from a flower on an ear of corn, Gallie explained. Initially the ear produces a pair of flowers for every kernel. But then one of the sister flowers undergoes abortion, resulting in one flower for each kernel. Gallie�s research group has developed technology that essentially rescues the aborted flower, resulting in two kernels that are fused together. �Despite the fusion, the kernels are not bigger,� Gallie said. �It�s basically the same corn, except that it is protein-rich and starch-poor � something that, if applied to sweet corn, would appeal to a large number of weight-conscious people in this country who are interested in low-carb diets and who normally avoid corn in their diets.�
Gallie and his colleagues published their work last year in The Plant Journal. Though their research focused on feed corn, the technology can easily be applied to sweet corn, a sugar-rich mutant strain of regular corn.
The U.S. Department of Agriculture, the National Science Foundation, and the California Agricultural Experiment Station funded the research.
Details of the study:
Flowers in the corn ear develop in pairs but one from each pair aborts before pollination can occur. Because of the role cytokinin, a plant hormone, plays in preventing organ death, Gallie�s research group introduced a gene that enabled production of cytokinin, thus rescuing the flowers. The kernels produced from pairs of flowers fused into a single normal-sized kernel that contained two embryos and a smaller endosperm, the food storage tissue that provides nutrients to the developing embryo. Because the embryo contains the majority of protein and oil, two embryos in the kernel doubles the protein and oil content in corn grain. The nutritional value of the grain improves also because the size of the endosperm, which contains most of the carbohydrates, is reduced.
Brief biography of Daniel Gallie:
Daniel Gallie received his doctoral degree in 1985 from the University of California, Davis. After completing postdoctoral studies at the John Innes Institute in Norwich, England, and at Stanford University, he joined UCR in 1990. During his career, Gallie has investigated the regulation of protein synthesis, the function of heat stress proteins, the control of cell death in plants, the role of plant hormones such as ethylene and cytokinin during plant growth and development, and the function of vitamin C in a plant�s response to adverse environmental conditions. Results from his group have been published in over 100 papers and patents. He is a member of the American Society of Plant Biologists, a professional society devoted to the advancement of the plant sciences.

Cornell tapped for regional Sun Grant hub to use $8 million in U.S. funds to spearhead next green revolution
September 21, 2005
Cornell University News Service
Susan S. Lang
http://www.news.cornell.edu/
ITHACA - In a time of skyrocketing gasoline prices and concerns over global warming, Cornell University is helping to spearhead the next green revolution by using plants to produce energy, industrial chemicals and green materials.
Awarded more than $8.2 million in federal funding over four years through the recent signing of the federal Transportation Bill, Cornell has been tapped by the federal government as one of five Sun Grant Centers of Excellence - regional hubs that will take the lead in researching the use of plant biomass in energy and chemical production; for education and outreach activities; and for soliciting and funding proposals that focus on using renewable agricultural resources to produce heat, electricity, biofuels, natural products, such as biopesticides and bioherbicides, and industrial chemicals.
"With our global community entering a less certain oil future, over the next 10 to 25 years, there will be a major transition to agricultural-based bio-industries," said Larry Walker, professor of biological and environmental engineering at Cornell and director of the institute.
Cornell, the land-grant university of New York state, is the lead university for the Northeast Sun Grant Institute of Excellence, which serves 14 states and the District of Columbia, from Maine to Maryland to Michigan. That makes Cornell one of only two universities in the nation, along with Oregon State University, now designated by the federal government in all of the four categories of land, sea, space and sun grant institutions.
"Genomics, nanobiotechnology and breakthroughs in molecular biology, genetics and biological engineering have opened up a broad spectrum of opportunities and challenges for manipulating microbial and plant systems to produce novel organic compounds and to meet part of the U.S. and world energy needs," said Walker. "Opportunities abound for integrating these advances in engineering and science into regional, national and global efforts to develop sustainable industries and communities."
Involving at least two dozen Cornell faculty members, the institute was established in 2004 at Cornell. But it was not until the passing of the Transportation Bill in August that the institute was given the funding needed to solicit and award competitive grants to regional land-grant universities to work in partnership with industry, governmental agencies, communities, private entrepreneurs and others stakeholders for bringing the bio-economy to the region.
The Northeast Sun Grant Initiative will focus on biopower - energy produced from renewable biomass for heat and electricity; biofuels - liquid and gaseous transportation fuels, such as bioethanol and biodiesel, made from biomass resources; and bioproducts - chemicals and materials that are traditionally made from petroleum-based resources but will be made from biomass. In each of these strategic areas, initiatives will involve feedstock development, conversion processes, systems integration and biomass public policy issues.
Currently, less than 10 percent of chemicals and commodities and less than 5 percent of U.S. energy supplies are derived from agriculturally based resources, Walker pointed out.
"Our vision is to rethink how many of the material needs of society can be met by using renewable agriculturally based raw materials," Walker said, noting that Cornell is an ideal location for the Northeast Sun Grant Institute because "it is one of very few institutions in the world that can bring together so many physical and life scientists, engineers and social scientists with the talent and interest in sustainable development, or that has access to so many bright young minds."
The Sun Grant centers not only will promote the development of bio-based energy technologies but also environmental sustainability as well as boost the economic vitality and diversity of rural communities, said Walker. He praised New York's congressional representatives - Sherwood Boehlert, Maurice Hinchey and Jerome Nadler as well as U.S. Senators Hillary Clinton and Charles Schumer - for their support of funding for the consortium. Gov. George Pataki's Washington office was also helpful in the political process, he said.
Michael Hoffman, director of the Cornell University Agricultural Experiment Station, said: "Funding of the Sun Grant is truly great news for Cornell, the Northeast and the nation. The Sun Grant is well positioned to help us diversify our energy supply portfolio, more important now then ever before, and generate a multitude of new natural products and industrial chemicals. We see many economic and environmental benefits for New York state farms and communities thanks to the Sun Grant."
The Northeast Sun Grant Institute at Cornell serves a region that includes the states of Connecticut, Delaware, Massachusetts, Maryland, Maine, Michigan, New Hampshire, New Jersey, New York, Ohio, Pennsylvania, Rhode Island, Vermont, Washington, D.C., and West Virginia. The other regional Sun Grant Centers of Excellence are at Oregon State University-Corvallis; University of Tennessee-Knoxville; Oklahoma State University, Stillwater; and South Dakota State University-Brookings.
Campus bio-energy and bioproducts projects:
With more than 400 life scientists at Cornell, a multitude of bio-energy and bioproducts projects are already under way on campus. They include:
pretreating switch grass and alfafa to improve their enzyme conversion to fermentable sugars;
engineering enzymes that are more effective in converting cellulose derived from herbaceous crops and grasses into fermentable sugars to be converted into industrial chemicals;
developing molecular ecology techniques to prospect for novel industrial enzymes and microorganisms from extreme environments;
engineering plants to effectively produce important industrial enzymes and industrial compounds;
applying nanofabrication and single-molecule confinement methods to investigate molecular mechanisms of important industrial enzymes;
enhancing ethanol tolerance and production in yeast through understanding and manipulating membrane restructuring;
converting dairy manure-derived biogas from anaerobic digestion to produce electricity, hydrogen and heat on dairy farms;
utilizing used vegetable oil from restaurants to replace diesel fuel for vehicles;
investigating the technical and economic constraints of using digester and landfill gases to operate fuel cells;
developing environmentally friendly bioherbicides to control plant-pathogenic bacteria and fungi;
screening molecules for novel compounds in diverse organisms for their genetic capacity to synthesize some important families of natural products, such as antibiotics and insecticides;
developing microbial biopesticides through combined approaches of genetic engineering, fermentation optimization and process engineering; and
testing the burning of grass pellets as a biofuel.
Many Cornell graduate students are involved in carrying out these research activities through the U.S. Department of Agriculture Multidisciplinary Graduate and Education Training Program for bio-based industries.

#4141

From: Doug Powell <dpowell@...>
Date: Fri Sep 23, 2005 2:59 am
Subject: Agnet Sept. 22/05

dpowell@...

how to subscribe

Are Europe's farmers warming to GMO maize?
September 22, 2005
Reuters
David Evans
PARIS - Farmers in five European Union countries, including France and Germany, have, according to this story, begun commercial growing of genetically modified (GMO) maize and industry officials were cited as saying on Thursday the trend will increase next year.
The story explains that Europe's harvest this autumn will see small amounts of Bt maize, gene-altered for resistance to the corn borer pest, reaped in France, Germany, Portugal and the Czech Republic to be used for animal feed.
The sown areas are�apart from Spain�limited to hundreds of hectares but the trend does allow the biotech lobby to claim something of a breakthrough on an issue that has caused major trade friction between the EU and United States.
Simon Barber, Director of Plant Biotechnology at EU biotech lobby EuropaBio, was quoted as saying "I find it encouraging that this year, the tenth of commercial cultivation, five European member states have given farmers the choice to grow GM crops."
The Bt maize was one of 18 crops approved by the EU before its unofficial moratorium on new GMO authorizations that ran from 1998 until last year. But the crops remain controversial.

Agnet Sept. 22/05

Are Europe's farmers warming to GMO maize?

Novel arabidopsis has enhanced ethylene response

Experts tout benefits of GM foods, suggest new labeling system

Review tackles minimizing variation of transgene expression

New kidney bean germplasm line resists common bacterial blight disease

Novel arabidopsis has enhanced ethylene response
September 22, 2005
CropBiotech Net
http://www.isaaa.org/kc/
Ethylene is a gaseous hormone involved in many aspects of the growth and development of plants. Annelies De Paepe and colleagues from Ghent University find that �The Arabidopsis mutant eer2 has enhanced ethylene responses in the light.�
They describe a new member of the class of enhanced ethylene response mutants, which may aid scientists in understanding the process of development and senescence in plants. Their research is published in the latest issue of the Journal of Experimental Botany. Using ethylene treatments on Arabidopsis plants, as well as studies of plant RNA, chlorophyll levels, and gene linkage, researchers found that the mutant phenotype is hypersensitive to ethylene applications. It does not senesce faster than the wild type, and can grow even on a low nutrient medium.
Subscribers to the Journal of Experimental Botany can read the article at http://jxb.oxfordjournals.org/cgi/content/full/56/419/2409. Other readers can take a look at the abstract at http://jxb.oxfordjournals.org/cgi/content/abstract/56/419/2409.

Experts tout benefits of GM foods, suggest new labeling system
September 22, 2005
Taiwan News
Jenny Hsu
http://www.etaiwannews.com/
Scholars and scientists from various parts of the world were cited as strongly advocating controversial genetic modification technology and a food traceability system to ease the world's food problems, at an International Symposium for the Risk Management of Genetically Modified Organisms yesterday.
They maintained that GMOs offer an effective way to produce better and more food to feed the world's rapidly growing population, and in addition, a food traceability system would increase consumer confidence and thus boost the local economy.
In Taiwan, genetically modified foods include papayas, soybeans and tomatoes. Currently, biotechnologists are working on developing other genetically modified fruits and vegetables such as bananas, watermelons, broccoli, and potatoes. They are also looking at ways to genetically modify animals such as pigs, cattle and various kinds of fish.
In his opening address, Lee Jen-chyuan, deputy minister of the Council of Agriculture was cited as saying that GMO development and use has become a global trend, adding, "We have to do a better job in communicating with our people. Only through communication can we resolve the controversies."
Dr. Ying Ye of the Bureau of Animal and Plant Health Inspection and Quarantine was cited as saying that Taiwan residents should feel safe consuming genetically modified foods or medicine and that Taiwan imposes strict regulatory standards and thorough assessments of possible toxins, allergens, and nutritional contents of all GMFs before they hit the market.
Dr. Allan McHughen, a professor from the University of California, Riverside.was quoted as saying that, "To accommodate all 6.2 billion people in the world, GM foods are the answer," adding that GMOs do not violate the laws of nature, but rather are a means of protecting the environment.

Review tackles minimizing variation of transgene expression
September 22, 2005
CropBiotech Net.
http://www.isaaa.org/kc/
Although gifted with the promise of rendering a plant immune to disease or insect attack, transgenes can sometimes be unstable and unpredictable. The sources of such variations include inconsistency in the copy numbers of the introduced gene or genes; somaclonal variation, or phenotypic differences amongst the biotech plants created; the site of insertion of the transgene; and RNA silencing in the host plant. As a result, researchers are spending more time and money to both achieve stable transgene expression, as well as to produce biotech crops with the expected level of expression.
Katleen M.J. Butaye and colleagues of the Katholieke Universiteit Leuven, Belgium review these techniques in �Approaches to minimize variation of transgene expression in plants.� The article is published in the latest issue of Molecular Breeding.
The review expounds on such techniques as Cre-Lox co-transformation, where the introduced gene is flanked by DNA sequences which will allow the gene to be stably integrated into the host genome. This technique has proven to be successful in mammalian cells, but is still inefficient for plants.
Other techniques include the use of new gene cassettes, viral suppressor genes, and, according to the researchers, the ultimate genetic engineering tool: plant artificial chromosomes.
Read the abstract at http://dx.doi.org/10.1007/s11032-005-4929-9. Subscribers to Molecular Breeding can access the full article through the same page.

New kidney bean germplasm line resists common bacterial blight disease
September 22, 2005
ARS News Service
Agricultural Research Service, USDA
www.ars.usda.gov/is/pr
A new germplasm line dubbed "USDK-CBB-15" is now available for breeding new varieties of dark red kidney beans that can resist common bacterial blight. Caused by the pathogen Xanthomonas axonopodis pv. phaseoli, bacterial blight is an endemic disease affecting bean crops east of the U.S. Continental Divide. Antibiotic treatment, clean-seed programs and sanitation are standard control measures. However, resistant crops are the key defense, according to Phil Miklas, a plant geneticist in the Agricultural Research Service's (ARS) Vegetable and Forage Crops Production Research Unit in Prosser, Wash. In susceptible bean plants, the disease symptoms include large brown blotches with lemon-yellow borders on leaf surfaces and small, discolored seed in infected pods. Severe outbreaks can cause yield losses of up to 40 percent in susceptible crops.
Miklas developed USDK-CBB-15 using marker-assisted selection, a method of detecting inherited genes that speeds the screening of plants for desired traits such as disease resistance. USDK-CBB-15 is the product of kidney bean crosses that Miklas made to incorporate resistance genes from the Great Northern bean cultivar "Montana Number 5" and the breeding germplasm line XAN
159.
James Smith, in ARS' Crop Genetics and Products Research Unit at Stoneville, Miss., and Shree Singh, with the University of Idaho at Kimberly, collaborated with Miklas on the new kidney bean's development, testing and evaluation. They will post a registration notice with detailed information on USDK-CBB-15 in an upcoming issue of the journal Crop Science. Miklas is handling seed requests. The United States is the sixth-leading producer of edible dry beans, generating farm sales of $451 million in 2001-03, according to the U.S. Department of Agriculture's Economic Research Service. Per-capita consumption of edible dry beans is 6.8 pounds, according to ERS, with kidney beans finding favor in soups, salads, chili and other dishes. Beans are also an excellent source of antioxidants, fiber, protein, and vitamins for healthy diets, Miklas notes.
ARS is USDA's chief in-house scientific research agency.

#4142

From: Doug Powell <dpowell@...>
Date: Fri Sep 23, 2005 12:49 pm
Subject: Agnet Sept. 23/05

dpowell@...

how to subscribe

Program launched for farmers to dispose of pesticides in safe, environmentally friendly manner
September 22, 2005
From a press release
NIAGARA FALLS, ON - CropLife Canada and its partners are pleased to announce the launch of the Ontario Waste Agricultural Pesticides Collection Program. From November 22 to 23, 2005, farmers can bring unwanted or old pesticides free of charge to 13 select farm supply dealers across Ontario.
The program is funded by CropLife Canada, the Ontario Ministry of the Environment, and Environment Canada. Funding for this project has also been provided by Agriculture and Agri-Food Canada through the Agricultural Adaptation Council's CanAdvance Program. The program is also supported by AGCare, the Ontario Agri Business Association and its network of participating agricultural dealers, and the Ontario Ministry of Agriculture, Food and Rural Affairs.
"We are pleased to be part of a program that provides farmers with a
safe, effective and cost-free way to properly dispose of unwanted products,"
says Cam Davreux, Vice-President, Stewardship, CropLife Canada. "This program is a great example of how government, grower organizations, and the agriculture industry can work cooperatively towards a better environment." The collection program will happen at Agri-Chemical Warehousing Standards Association (AWSA) sites across Ontario certified to handle and properly store pesticides. A contractor approved by the Ontario Ministry of the Environment will then dispose of the old pesticides. The following products will not be accepted: empty pesticide containers, treated seed, home/garden pesticides, paints, thinners, waste oils or any other household hazardous wastes. "This program provides farmers the opportunity to properly dispose of agricultural and commercial pesticides and protect our environment from the risk of contamination," says the Honourable St�phane Dion, Canada's Minister of the Environment. "This demonstrates how well we can work together for the benefit of all Canadians and the environment. Actions which benefit our environment not only support our natural resources but also our economic prosperity, particularly for an industry as important in Canada as farming." "The Ontario government is committed to improving the environmental health of all Ontarians," says Laurel Broten, Minister of the Environment. "By offering this safe, free, and convenient way to dispose of old or unwanted pesticides, we're working together with our partners to make a difference. It's good for farmers and it's good for the environment." "These types of programs build upon industry's commitments to environment and public health," says Lorne Hepworth, President of CropLife Canada. "Stewardship has and will always be our number one priority. This collection program is part of CropLife Canada's stewardshipfirst� program which promotes safe and responsible handling of crop protection products from development through to disposal."
For more information on the Ontario Waste Agricultural Pesticides Collection Program, including a list of collection sites and details on how to safely transport your pesticides, ask your farm supply dealer, call 1-877-424-1300 (toll free), or visit www.croplife.ca Note to Editor: The 13 sites where farmers can drop off their unwanted pesticides safely and free-of-charge between November 22 and 23 are:
ONTARIO OBSOLETE COLLECTION PROGRAM SITES
Cardinal Farm Supply Box 970, County Rd. 10 Alliston 705-435-4368 Ltd.
W.G. Thompson Sons R.R.1 Bethany 705-277-2002 Ltd.
Brussels Agromart 251 Albert Brussels 519-887-6273 Ltd.
Woodrill Farms Ltd. R.R. No. 2, Hwy No. 7 Guelph 519-821-1018
Sprucedale Agromart Box 68, Side Road Hanover 519-364-4070
Ltd. No. 25
Cargill Limited 22637 Melbourne St. Melbourne 519-289-2067
Sylvite Agri-Services Box 179, Hwy 59 South Norwich 519-468-3720 Ltd.
Harvex Agromart 2109-B, County Road Oxford 613-258-3445
No. 20 Station
County Farm Centre 3 Cold Storage Road Picton 613-476-2171
Co-operative 723 Gingras Ave. Verner 705-594-1268
Regionale de Nip.
Sudbury Ltd.
Clarke Agri Service 4891 Canboro Rd. Wellandport 905-386-6293
Agro Culture 2000 2311 Chemin du Comte 8 Cassleman 613-764-5599
Highway 138
Cargill Limited 17 Tilbury Street Tilbury 519-682-1481

Agnet Sept. 23/05

Program launched for farmers to dispose of pesticides in safe, environmentally friendly manner

The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield

Inert ingredients; revocation of 34 pesticide tolerance exemptions for 31 chemicals

Aminopyridine, Ammonia, Chloropicrin, Diazinon, Dihydro-5-heptyl-2(3H)-furanone, Dihydro-5-pentyl-2(3H)-furanone, and Vinclozolin; Tolerance Actions

Bacillus thuringiensis cry34ab1 and cry35ab1 proteins and the genetic material necessary for their production in corn; exemption from the requirement of a tolerance

Boscalid; pesticide tolerances for emergency exemptions

Cyhexatin; tolerance actions

Iprovalicarb; pesticide tolerance

Lindane; tolerance actions

Myclobutanil; re-establishment of a tolerance for emergency exemption

Reynoutria sachalinensis extract; exemption from the requirement of a tolerance

C8, C10, and C12 straight-chain fatty acid monoesters of glycerol and propylene glycol; amendment to tolerance exemption

MGK[reg] 264 revised risk assessments, notice of availability, and solicitation of risk reduction options

Piperonyl butoxide revised risk assessments; notice of availability and solicitation of risk reduction options

Pyrethrins revised risk assessments, notice of availability, and solicitation of risk reduction options agency: environmental protection agency (EPA).

Ametryn Reregistration eligibility decision

Flusilazole; receipt of application for emergency exemption, solicitation of public comment

Flutriafol; receipt of application for emergency exemption, solicitation of public comment

Metconazole; receipt of application for emergency exemption, solicitation of public comment

The endophytic fungus Piriformospora indica reprograms barley to salt-stress tolerance, disease resistance, and higher yield
September 20, 2005
Proceedings of the National Academy of Sciences (PNAS)
Frank Waller * {dagger}, Beate Achatz * {dagger}, {ddagger}, Helmut Baltruschat * {dagger}, J�zsef Fodor �, Katja Becker �, Mari
*Institute of Phytopathology and Applied Zoology, University of Giessen, D-35392 Giessen, Germany; {ddagger}Institute for Vegetables and Ornamental Crops, D-14979 Grossbeeren, Germany; �Plant Protection Institute, Hungarian Academy of Sciences, H-1525 Budapest, Hungary; �Institute of Nutritional Biochemistry, University of Giessen, D-35392 Giessen, Germany; and ||Department of Crop and Soil Sciences, Washington State University, Pullman, WA 99164-6420
Contributed by Diter von Wettstein, May 31, 2005
Disease resistance strategies are powerful approaches to sustainable agriculture because they reduce chemical input into the environment. Recently, Piriformospora indica, a plant-root-colonizing basidiomycete fungus, has been discovered in the Indian Thar desert and was shown to provide strong growth-promoting activity during its symbiosis with a broad spectrum of plants [Verma, S. et al. (1998) Mycologia 90, 896-903]. Here, we report on the potential of P. indica to induce resistance to fungal diseases and tolerance to salt stress in the monocotyledonous plant barley. The beneficial effect on the defense status is detected in distal leaves, demonstrating a systemic induction of resistance by a root-endophytic fungus. The systemically altered "defense readiness" is associated with an elevated antioxidative capacity due to an activation of the glutathione-ascorbate cycle and results in an overall increase in grain yield. Because P. indica can be easily propagated in the absence of a host plant, we conclude that the fungus could be exploited to increase disease resistance and yield in crop plants.

Inert ingredients; revocation of 34 pesticide tolerance exemptions for 31 chemicals
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55293-55296]
[DOCID:fr21se05-23]
[OPP-2005-0069; FRL-7737-3]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: EPA is revoking 34 exemptions from the requirement of a tolerance that are associated with 31 inert ingredients because these substances are no longer contained in active Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) pesticide product registrations.
These ingredients are subject to reassessment by August 2006 under section 408(q) of the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA). The 34 tolerance exemptions are considered ``reassessed'' for purposes of FFDCA's section 408(q).DATES: This regulation is effective September 21, 2005. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit XI. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for this action under docket identification (ID) number OPP-2005-0069. All documents in the docket
are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Karen Angulo, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 306-0404; e-mail address: angulo.karen@....

Aminopyridine, Ammonia, Chloropicrin, Diazinon, Dihydro-5-heptyl-2(3H)-furanone, Dihydro-5-pentyl-2(3H)-furanone, and Vinclozolin; Tolerance Actions
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55263-55268]
[DOCID:fr21se05-17]
[[Page 55263]]
[OPP-2005-0209; FRL-7732-5]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: EPA is revoking specific tolerances and tolerance exemptions for residues of the bird repellent 4-aminopyridine, fungicides ammonia and vinclozolin, and insecticides chloropicrin, diazinon, dihydro-5-heptyl-2(3H)-furanone, and dihydro-5-pentyl-2(3H)-furanone. EPA canceled food use registrations or deleted food uses from registrations following requests for voluntary cancellation or use deletion by the registrants, or non-payment of registration maintenance fees. The regulatory actions in this document contribute toward the Agency's tolerance reassessment requirements of the Federal Food, Drug, and Cosmetic Act (FFDCA) section 408(q), as amended by the Food Quality Protection Act (FQPA) of 1996. By law, EPA is required by August 2006 to reassess the tolerances in existence on August 2, 1996. The regulatory actions in this document pertain to the revocation of 39 tolerances and tolerance exemptions of which 33 count as tolerance reassessments toward the August, 2006 review deadline.
DATES: This regulation is effective September 21, 2005. However, certain regulatory actions will not occur until the date specified in the regulatory text. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit IV. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for thisaction under Docket identification (ID) number OPP-2005-0209. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Joseph Nevola, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-8037; e-mail address:nevola. joseph@....

Bacillus thuringiensis cry34ab1 and cry35ab1 proteins and the genetic material necessary for their production in corn; exemption from the requirement of a tolerance
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55254-55260]
[DOCID:fr21se05-15]
[OPP-2005-0211; FRL-7735-4]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes an exemption from the requirement of a tolerance for residues of the Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins and the genetic material necessary for their production in corn on corn, field; corn, sweet; and corn, pop when applied/used as a plant-incorporated protectant. Mycogen Seeds c/o Dow AgroSciences LLC submitted a petition to EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA), requesting an exemption from the requirement of a tolerance. This regulation eliminates the [[Page 55255]] need to establish a maximum permissible level for residues of Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins and the genetic material necessary for their production in corn.
DATES: This regulation is effective September 21, 2005. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VIII. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2005-0211. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Mike Mendelsohn, Biopesticides and
Pollution Prevention Division (7511C), Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-8715; e-mail address: mendelsohn.mike@....

Boscalid; pesticide tolerances for emergency exemptions
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55286-55293]
[DOCID:fr21se05-22]
ENVIRONMENTAL PROTECTION AGENCY
40 CFR Part 180
[OPP-2005-0259; FRL-7737-9]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes a time-limited tolerance for residues of boscalid, 3-pyridinecarboxamide, 2-chloro-N-(4'-chloro[1,1'-biphenyl]-2-yl) in or on tangerines. This action is in response to EPA's granting of an emergency exemption under section 18 of the Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) authorizing use of the pesticide on mandarin oranges and mandarin hybrids. ``Tangerines'' is the accepted regulatory term used for these crops and a tolerance on tangerines covers both mandarin oranges and mandarin hybrids. This regulation establishes a maximum permissible level for residues of boscalid in this food commodity. The tolerance will expire and is revoked on December 31, 2008.
DATES: This regulation is effective September 21, 2005. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VII. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2005-0259. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other informationwhose disclosure is restricted by statute.
Certain other[[Page 55287]]material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Andrew Ertman, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-9367; e-mail address: Sec-18-Mailbox@....

Cyhexatin; tolerance actions
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
Published: 21.sep.05
[Page 55269-55272]
[DOCID:fr21se05-18]
[[Page 55269]]
[OPP-2005-0160; FRL-7732-8]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: EPA is revoking, under the Federal Food, Drug, and Cosmetic
Act (FFDCA) section 408(e)(1), all existing tolerances for residues of the insecticide/acaricide cyhexatin because they do not meet requirements of FFDCA section 408(b)(2). EPA canceled food use registrations for cyhexatin in 1989. Currently, EPA determined that acute dietary risks from use of cyhexatin on commodities for which import tolerances exist exceed the Agency's level of concern. However, EPA also determined that if the only cyhexatin tolerance is for orange juice, there is a reasonable certainty that no harm to any population subgroup will result from exposure to cyhexatin treated oranges. Because manufacturers support a cyhexatin tolerance on orange juice for purposes of importation and the Agency has made a determination of safety for such a tolerance, EPA is establishing, concurrent with the revocation of the citrus fruit group tolerance, an individual time-limited tolerance on orange juice. The regulatory actions in this document contribute toward the Agency's tolerance reassessment requirements of the FFDCA section 408(q), as amended by the Food Quality Protection Act (FQPA) of 1996. By law, EPA is required by August 2006 to reassess the tolerances in existence on August 2, 1996. The regulatory actions in this document pertain to the revocation of 41 tolerances which count as tolerance reassessments toward the August, 2006 review deadline.
DATES: This regulation is effective September 21, 2005. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing requestfollow the detailed instructions as provided in Unit IV. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under docket identification (ID) number OPP-2005-0160. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Joseph Nevola, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-8037; e-mail address: nevola.joseph@....

Iprovalicarb; pesticide tolerance
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55277-55282]
[DOCID:fr21se05-20]
OPP-2005-0074; FRL-7736-2]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes a tolerance for residues of Iprovalicarb in or on tomatoes. Bayer CropScience AG requested this tolerance under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA). DATES: This regulation is effective September 21, 2005. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing request follow the
detailed instructions as provided in Unit VI. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for this action under Docket
identification (ID) number OPP-2005-0074. All documents in the docket
are listed in the EDOCKET index athttp://www.epa.gov/edocket. Although
listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on
the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Mary L. Waller, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-9354; e-mail address:waller.mary@....

Lindane; tolerance actions
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55282-55286]
[DOCID:fr21se05-21]
[OPP-2004-0246; FRL-7734-3]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: EPA is revoking specific existing tolerances for the insecticide lindane because, following receipt of registrant requests, the Agency canceled their associated Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) registrations in the United States.
DATES: This regulation is effective September 21, 2005. However, certain regulatory actions will not occur until the date specified in the regulatory text. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit IV. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2004-0246. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Joseph Nevola, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-8037; e-mail address: nevola.joseph@....

Myclobutanil; re-establishment of a tolerance for emergency exemption
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55260-55262]
[DOCID:fr21se05-16]
[OPP-2005-0248; FRL-7736-1]
AGENCY: Environmental Protection Agency (EPA). ACTION: Final rule.
SUMMARY: This regulation re-establishes a time-limited tolerance for combined residues of the fungicide myclobutanil and its metabolite in or on artichoke, globe at 1.0 parts per million (ppm) for an additional 21/89/21/13/23/85/83/8 year period. This tolerance will expire and is revoked on December 31, 2007. This action is in response to EPA's granting of an emergency exemption under section 18 of the Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) authorizing use of the pesticide on artichoke, globe. Section 408(l)(6) of the Federal Food, Drug, and Cosmetic Act (FFDCA) requires EPA to establish a time-limited tolerance or exemption from the requirement for a tolerance for pesticide chemical residues in food that will result from the use of a pesticide under an emergency exemption granted by EPA under FIFRA section 18.
DATES: This regulation is effective September 21, 2005. Objections and requests for hearings must be received on or before November 21, 2005. ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit III. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2005-0248.
All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/ edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Stacey Milan Groce, Registration Division (7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-epa.gov.

Reynoutria sachalinensis extract; exemption from the requirement of a tolerance
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55272-55277]
[DOCID:fr21se05-19]
[OPP-2005-0221; FRL-7730-3]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes an exemption from the requirement of a tolerance for residues of the biochemical pesticide Reynoutria sachalinensis extract on all food commodities. The Interregional Research Project Number 4 (IR-4), on behalf of KHH Bioscience, Inc., submitted a petition to EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA), [[Page 55273]]
requesting an exemption from the requirement of a tolerance. This regulation eliminates the need to establish a maximum permissible level for residues of Reynoutria sachalinensis extract. DATES: This regulation is effective September 21, 2005. Objections and requests for hearings must be received on or before November 21, 2005.
ADDRESSES: To submit a written objection or hearing request follow the
detailed instructions as provided in Unit VIII. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for this action under Docket
identification (ID) number OPP-2005-0221. All documents in the docket
are listed in the EDOCKET index at http://www.epa.gov/edocket. Although
listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on
the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Driss Benmhend, Biopesticides and
Pollution Prevention Division (7511C), Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-9525; e-mail address: benmhend.driss@....

C8, C10, and C12 straight-chain fatty acid monoesters of glycerol and propylene glycol; amendment to tolerance exemption
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55326-55329] [DOCID:fr21se05-42] [OPP-2004-0344; FRL-7719-7]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Proposed rule.
SUMMARY: This document proposes to amend an exemption from the requirement of a tolerance for residues of the C8, C10, and C12 straight- chain fatty acid monoesters of glycerol and propylene glycol on all food commodities when applied/used for both pre-harvest and post-harvest purposes. On June 23, 2004, EPA established an exemption from the requirement of a tolerance for these residues but did not expressly approve post-harvest uses in accordance with 40 CFR 180.1(i). Therefore, EPA is proposing this regulation, to amend the existing tolerance exemption to allow for post-harvest uses of C8, C10, and C12 straight-chain fatty acid monoesters of glycerol and propylene glycol in accordance with section 408(e) of the Federal Food, Drug, and Cosmetic Act (FFDCA) as amended by the Food Quality Protection Act of 1996 (FQPA). DATES: Comments, identified by docket ID number OPP-2004-0344, must be received on or before October 6, 2005. ADDRESSES: Submit your comments, identified by docket ID number OPP-2004-0344, by one of the following methods: Federal eRulemaking Portal: http://www.regulations.gov/. Follow the on- [[Page 55327]] line instructions for submitting comments. Agency Website: http://www.epa.gov/edocket/. EDOCKET, EPA's electronic public docket and comment system, is EPA's preferred method for receiving comments. Follow the on-line instructions for submitting comments. E-mail: Comments may be sent by e-mail to opp-docket@..., Attention: Docket ID Number OPP-2004-0344. Mail: Public Information and Records Integrity Branch (PIRIB) (7502C), Office of Pesticide Programs (OPP), Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001, Attention: Docket ID Number OPP-2004-0344. Hand delivery: Public Information and Records Integrity Branch (PIRIB), Office of Pesticide Programs (OPP), Environmental Protection Agency, Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA, Attention: Docket ID Number OPP-2004-0344. Such deliveries are only accepted during the Docket's normal hours of operation, and special arrangements should be made for deliveries of boxed information. Instructions: Direct your comments to docket ID number OPP-2004- 0344. EPA's policy is that all comments received will be included in the public docket without change and may be made available online at http://www.epa.gov/edocket/, including any personal information provided, unless the comment includes information claimed to be Confidential Business Information (CBI) or other information whose disclosure is restricted by statute. Do not submit information that you consider to be CBI or otherwise protected through EDOCKET, regulations.gov, or e-mail. The EPA EDOCKET and the regulations.gov websites are ``anonymous access'' systems, which means EPA will not know your identity or contact information unless you provide it in the body of your comment. If you send an e-mail comment directly to EPA without going through EDOCKET or regulations.gov, your e-mail address will be automatically captured and included as part of the comment that is placed in the public docket and made available on the Internet. If you submit an electronic comment, EPA recommends that you include your name and other contact information in the body of your comment and with any disk or CD ROM you submit. If EPA cannot read your comment due to technical difficulties and cannot contact you for clarification, EPA may not be able to consider your comment. Electronic files should avoid the use of special characters, any form of encryption, and be free of any defects or viruses. For additional information about EPA's public docket visit EDOCKET on-line or see the Federal Register of May 31, 2002 (67 FR 38102) (FRL-7181-7).Docket: All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket/. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This Docket Facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The Docket telephone number is (703) 305-5805. FOR FURTHER INFORMATION CONTACT: Carol E. Frazer, Biopesticides and Pollution Prevention Division (7511C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-8810; fax number: (703) 308-7026; e-mail address: frazer.carol@....

MGK[reg] 264 revised risk assessments, notice of availability, and solicitation of risk reduction options
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55381-55383]
[DOCID:fr21se05-70]
[[Page 55381]]
ENVIRONMENTAL PROTECTION AGENCY [OPP-2005-0040; FRL-7737-2]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: This notice announces the availability of EPA's revised risk assessments for the insecticide synergist N-Octyl bicycloheptene dicarboximide (MGK[reg] 264). In addition, this notice solicits public comment on risk reduction options for MGK[reg] 264. The public is encouraged to suggest risk management ideas or proposals to address the risks identified. EPA is developing a Reregistration Eligibility Decision (RED) for MGK[reg] 264 through the full, 6-Phase public participation process that the Agency uses to involve the public in developing pesticide reregistration and tolerance reassessment decisions. Through these programs, EPA is ensuring that all pesticides meet current health and safety standards. This notice begins phase 5 of the 6 phase process. DATES: Comments, identified by docket identification (ID) number OPP-2005-0040, must be received on or before November 21, 2005. ADDRESSES: Comments may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Cathryn O'Connell, Special Review and Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-0136; fax number: (703) 308-8041; e-mail address: oconnell.cathryn@...

Piperonyl butoxide revised risk assessments; notice of availability and solicitation of risk reduction options
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Federal Register: September 21, 2005 (Volume 70, Number 182)]
[Page 55383-55385]
[DOCID:fr21se05-71]
[OPP-2005-0042; FRL-7736-9]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: This notice announces the availability of EPA's revised risk assessments for the insecticide synergist piperonyl butoxide. In addition, this notice solicits public comment on risk reduction options for piperonyl butoxide. The public is encouraged to suggest risk management ideas or proposals to address the risks identified. EPA is developing a Reregistration Eligibility Decision (RED) for piperonyl butoxide through the full, 6-Phase public participation process that the Agency uses to involve the public in developing pesticide reregistration and tolerance reassessment decisions. Through these programs, EPA is ensuring that all pesticides meet current health and safety standards. This notice begins Phase 5 of the 6-Phase public participation process.
DATES: Comments must be received on or before November 21, 2005. ADDRESSES: Comments, identified by docket identification (ID) number OPP-2005-0042, may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Cathryn O'Connell, Special Review and Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-0136; fax number: (703) 308-8041; e-mail address: oconnell.cathryn@....

Pyrethrins revised risk assessments, notice of availability, and solicitation of risk reduction options agency: environmental protection agency (EPA).
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55378-55380]
[DOCID:fr21se05-69]
ENVIRONMENTAL PROTECTION AGENCY [OPP-2005-0043; FRL-7737-1]
ACTION: Notice.
SUMMARY: This notice announces the availability of EPA's revised risk assessments for the pesticide pyrethrins. In addition, this notice solicits public comment on risk reduction options for pyrethins. The public is encouraged to suggest risk management ideas or proposals to address the risks identified. EPA is developing a Reregistration Eligibility Decision (RED) for pyrethrins through the full, 6-Phase public participation process that the Agency uses to involve the public in developing pesticide reregistration and tolerance reassessment decisions. Through these programs, EPA is ensuring that all pesticides meet current health and safety standards. This notice begins Phase 5 of the 6-Phase process.
DATES: Comments, identified by docket identification (ID) number OPP-2005-0043, must be received on or before November 21, 2005. ADDRESSES: Comments may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Cathryn O'Connell, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs,
Environmental Protection Agency, 1200 Pennsylvania Ave., NW.,
Washington, DC 20460-0001; telephone number: (703) 308-0136; fax
number: (703) 308-8041; e-mail address: oconnell.cathryn@...

Ametryn Reregistration eligibility decision
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55385-55386]
[DOCID:fr21se05-72]
ENVIRONMENTAL PROTECTION AGENCY [OPP-2005-0411; FRL-7737-6]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: This notice announces the availability of EPA's Reregistration Eligibility Decision (RED) for the pesticide ametryn. The Agency's risk assessments and other related documents also are available in the ametryn Docket. Ametryn is a triazine herbicide used on field corn, popcorn, pineapple, and sugarcane. EPA has reviewed ametryn through the public participation process that the Agency uses to involve the public in developing pesticide reregistration and tolerance reassessment decisions. Through these programs, EPA is ensuring that all pesticides meet current health and safety standards.
FOR FURTHER INFORMATION CONTACT: Mark T. Howard, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-8172; fax number: (703) 308-8005; e-mail address: howard.markt@....

Flusilazole; receipt of application for emergency exemption, solicitation of public comment
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55386-55388]
[DOCID:fr21se05-73]
ENVIRONMENTAL PROTECTION AGENCY [OPP-2005-0242; FRL-7734-7]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: EPA has received a quarantine exemption request from the Minnesota and South Dakota Departments of Agriculture to use the pesticide flusilazole (Punch 3.3EC), CAS No. 85509-19-9, and a flusilazole + famoxadone premix (Charisma 1.7 EC) on soybeans to control Asian soybean rust. The Applicant proposes the use of a new chemical which has not been registered by the EPA. EPA is soliciting public comment before making the decision whether or not to grant the exemption.
DATES: Comments, identified by docket identification (ID) number OPP-2005-0242, must be received on or before October 6, 2005. ADDRESSES: Comments may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Carmen Rodia, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Avenue, NW., Washington, DC 20460-0001; telephone number: (703) 306-0327; fax number: (703) 308-5433; e-mail address: rodia.carmen@....

Flutriafol; receipt of application for emergency exemption, solicitation of public comment
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55388-55390]
[DOCID:fr21se05-74]
ENVIRONMENTAL PROTECTION AGENCY [OPP-2005-0243; FRL-7734-6]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: EPA has received a quarantine exemption request from the Minnesota and South Dakota Departments of Agriculture to use the pesticide product flutriafol (Impact 125SC), (CAS No. 76674-21-0), on soybeans to control Asian soybean rust. The Applicant proposes the use of a new chemical which has not been registered by EPA. EPA is soliciting public comment before making the decision whether or not to grant the exemption.
DATES: Comments, identified by docket identification (ID) number OPP-2005-0243, must be received on or before October 6, 2005. ADDRESSES: Comments may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Carmen Rodia, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Avenue, NW., Washington, DC 20460-0001; telephone number: (703) 306-0327; fax number: (703) 308-5433; e-mail address: rodia.carmen@....

Metconazole; receipt of application for emergency exemption, solicitation of public comment
September 21, 2005
[Federal Register: (Volume 70, Number 182)]
[Page 55390-55392]
[DOCID:fr21se05-75]
[OPP-2005-0241; FRL-7734-8]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: EPA has received a quarantine exemption request from the Minnesota and South Dakota Departments of Agriculture to use the pesticide metconazole (Caramba 90SL), CAS No. 125116-23-6, and a metconazole + pyraclostrobin co-pack (Headline-Caramba co-pack) on soybeans to control Asian soybean rust. Initially, a metconazole + pyraclostrobin premix product (Operetta 180EC) was also included in this quarantine exemption request. Operetta 180EC was subsequently withdrawn as a section 18 candidate. The Applicant proposes the use of a new chemical which has not been registered by the EPA. EPA is soliciting public comment before making the decision whether or not to grant the exemption.
DATES: Comments, identified by docket identification (ID) number OPP-2005-0241, must be received on or before October 6, 2005. ADDRESSES: Comments may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in [[Page 55391]]
Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Carmen Rodia, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Avenue, NW., Washington, DC 20460-0001; telephone number: (703) 306-0327; fax number: (703) 308-5433; e-mail address: rodia.carmen@....

#4143

From: Doug Powell <dpowell@...>
Date: Fri Sep 23, 2005 11:15 pm
Subject: Agnet Sept. 23/05 -- II

dpowell@...

how to subscribe

GMOs not the silver bullet that'll solve agriculture's problems
September 23, 2005
The Charlottetown Guardian
Danny Hendricken, district director of the National Farmers Union, writes to address some of the points that Eddy Dykerman made in his article 'GMOs can benefit the farmer, society and the environment' (The Guardian, Sept. 19, 2005).
GMOs are not the silver bullet we are seeking to reverse or resolve the problems associated with industrial agriculture (soil degradation and unacceptable low farm incomes, to mention a few).
When are we finally going to come to the realization that when we try to manipulate and control nature, we lose? Early in our education system we were taught that altering our environment in even the slightest manner would have grave consequences on the entire animal kingdom. But here we are today genetically changing plants in a manner that could never happen naturally. The scientists and the companies that have developed this technology believe that it is preposterous that anyone would question the legitimacy of their research.
Our governments constantly tell us that they make decisions regarding the introduction of new GM foods on the basis of 'sound science'. So Canadians should ask: How sound is the science on human health risks posed by GM foods? How many peer-reviewed papers on the health effects of GM foods have been published in academic journals?
Hendricken says that as of 2003, there existed only 10 such papers. And only five of those studies are independent (not 'performed more or less in collaboration with private companies'). And all five of these independent studies report adverse effects from feeding GM foods to lab animals. These are the findings of a 2003 study by Dr. Ian Pryme and Dr. Rolf Lembcke published in the journal Nutrition and Health.
In the U.S., the most recent look at the question of pesticide use is by Dr. Charles Benbrook in his paper entitled 'Genetically Engineered Crops and Pesticide Use in the United States: The First Nine Years'. Benbrook finds that since 1996 " ... GE crops ... have increased corn, soybean, and cotton pesticide use by 122.4 million pounds, or about four per cent." Further, the rate of increase is increasing - peaking at over 16 per cent in 2004.
It is important to remember that no commercially grown crop has been genetically modified for higher yield. The two most common modifications are resistance to glyphosate (often called 'herbicide tolerant' or 'HT'; or 'Roundup Ready', after the most popular brand of glyphosate) and the expression of the Bacillus thuringiensis (Bt) insecticide. Neither of these modifications directly increases yield. The implication is that they can increase yield indirectly - by reducing weed or insect pressures. There is no evidence, however, that GM seeds increase yields, either directly or indirectly.
When GM crops were first introduced, environmental advocates and others raised the prospect of contamination and 'gene flow'. Monsanto and other technology developers said that this could never happen. Now it is universally recognized that GM plants outcross promiscuously.
And even when GM seed companies first admitted that GM crops outcross and contaminate, these companies claimed that it was only over a limited range. Where companies admitted the need for buffer strips, they advocated buffers of just a few yards. Now we understand that GM pollen travels dozens of kilometres. At every turn, and without any data, GM-seed sellers and promoters have recklessly claimed to have knowledge of the environmental safety of GM crops when in fact they were completely ignorant of how such crops will actually act in the biosphere. Even today, they and we remain ignorant.
In terms of increasing our market share for agricultural exports, the general public may be interested in a response to a Canadian Wheat Board survey. The customers that purchase 87 per cent of the Canadian wheat crop said that they will stop buying Canadian wheat if we introduce GM varieties. Our customers are clear: not only will they refuse to buy GM wheat from Canada, they will cease buying all wheat from us, because they simply did not believe the GM wheat could be segregated from non-GM. Certainly not an overwhelming show of confidence by importing countries.
Around the world, academics, citizens and civil society organizations are raising concerns about a global food system increasingly controlled by corporations such as Cargill, Wal-Mart, and Monsanto. And if corporate control of our food supply is something to be concerned about, control of seed is a key concern. Monsanto and a tiny number of other companies are tightening their grip, not merely on our seeds, but on the genes - the building blocks of life. In effect, we are turning control of our seed supply over to a tiny number of global transnationals, in return, it is implied, for the benefits of the seeds that they will produce. But since such benefits are nearly absent, we may want to reconsider our bargain with these companies.
The suggestion that this technology will not have a negative impact on our province, in my opinion, is misleading. As a food producer, I certainly would like to believe it could benefit our industry and society. But by unleashing this into the food system it raises more concerns than it addresses. There may well be a time in the future when we can utilize this technology safely without compromising the integrity of our ecosystems and health, but that time is not currently at hand.

Agnet Sept. 23/05 -- II

GMOs not the silver bullet that'll solve agriculture's problems

Farmers contacted, farm group against destruction

Phylate-free to decrease water pollution, increase nutrient up-take

Genetic engineering of terpenoid metabolism attracts bodyguards to arabidopsis

Summary document of the FAO e-mail conference: "Public participation in decision-making regarding gmos in developing countries: How to effectively involve rural people"

Pesticides; removal of expired time-limited tolerance exemptions

Fenpropathrin; pesticide tolerance

Kasugamycin; pesticide tolerance

Pyriproxyfen; pesticide tolerance

Amicarbazone; pesticide tolerance

Pyridaben; pesticide tolerance

Malathion; revised risk assessments, notice of availability, and solicitation of risk reduction options

Pesticide reregistration performance measures and goals

Farmers contacted, farm group against destruction
September 23, 2005
ABC
http://www.abc.net.au/
The Australian Grains Research and Development Corporation (GRDC) is, according to this story, contacting farmers who are hosting canola trials found to be contaminated with genetically-modified (GM) material.
The story says that GRDC has confirmed GM contamination of two lines of conventional canola being grown at 33 sites across the country as part of its national variety trial (NVT).
Managing director Peter Reading was cited as saying that individual state governments and affected farmers will decide if the trials will destroyed, adding, "So far we have been advised to take no action on any of the trials, the other thing we have been doing is in the process of contacting the growers on which those sites, the NT sites are located, explaining to them the situation and giving them the option if they would like us to remove those plots we will do so."
Graingrowers in Victoria's Wimmera are divided over the risks of GM contamination.
"Before too long we're going to be into GM, so perhaps it is not the disaster that it first appears," said one farmer.
"The GM lobby are saying segregation. Now if they do bring GM in, we'll segregate it. Well, obviously they can't even segregate it at very low levels. So how can they segregate it when it is an open industry," said another farmer.
"It is probably important to keep it separate, but we do need to have that technology available to us, so the moratorium should be lifted so we can study it a bit closer before it is released," said a third farmer.
The New South Wales Farmers Association was cited as saying that canola trials contaminated by genetically modified (GM) canola should not be destroyed.
Recently nine canola trials run by the Department of Primary Industries in the state had to be destroyed because of GM contamination.
But the Grains Research and Development Corporation has confirmed GM contamination of another two lines of conventional canola.
There is no plan as yet for these trial crops to be destroyed and the farmers' association's Angus McLaren says they should continue.

Phylate-free to decrease water pollution, increase nutrient up-take
September 23, 2005
Food Security and Ag-Biotech
http://www.merid.org/fs-agbiotech/
Researchers at Duke University in the U.S. have developed genetically modified (GM) Arabidopsis thaliana plants that are free of phylates.
The researchers say that the GM plants provide a commercially viable model for the development of phylate-free GM grain.
According to the article, phylates are found in grain crops like corn and soy, where they pose health and environmental problems. The chemicals block the uptake of essential metals in people. This is particularly problematic with the grain-rich diets of the developing world.
Phylates also create water pollution when livestock are fed with grain. The animals are unable to process the chemicals, which then get released into the environment.
The researchers' findings are published in the August 30 edition of the Proceedings of the National Academy of Sciences (PNAS). An abstract of the PNAS article is available online at the link below.
http://www.pnas.org/cgi/content/abstract/102/35/12612

Genetic engineering of terpenoid metabolism attracts bodyguards to arabidopsis
September 23, 2005
Science, Vol 309, Issue 5743, 2070-2072
Iris F. Kappers,1,2* Asaph Aharoni,2,3* Teun W. J. M. van Herpen,2 Ludo L. P. Luckerhoff,1,2 Marcel Dicke,1 Harro J. Bouwmeester
Iris F. Kappers,1,2* Asaph Aharoni,2,3* Teun W. J. M. van Herpen,2 Ludo L. P. Luckerhoff,1,2 Marcel Dicke,1 Harro J. Bouwmeester2{dagger}
Herbivore-damaged plants release complex mixtures of volatiles that attract natural enemies of the herbivore. To study the relevance of individual components of these mixtures for predator attraction, we manipulated herbivory-induced volatiles through genetic engineering. Metabolic engineering of terpenoids, which dominate the composition of many induced plant volatile bouquets, holds particular promise. By switching the subcellular localization of the introduced sesquiterpene synthase to the mitochondria, we obtained transgenic Arabidopsis thaliana plants emitting two new isoprenoids. These altered plants attracted carnivorous predatory mites (Phytoseiulus persimilis) that aid the plants' defense mechanisms.
1 Laboratory of Entomology, Wageningen University, Post Office Box 8031, 6700 EH Wageningen, Netherlands.
2 Plant Research International, Wageningen University and Research Centre, Post Office Box 16, 6700 AA Wageningen, Netherlands.
3 Weizmann Institute of Science, Post Office Box 26, Rehovot 76100, Israel.
These authors contributed equally to this work.
{dagger} To whom correspondence should be addressed. E-mail: harro.bouwmeester@...

Pesticides; removal of expired time-limited tolerance exemptions
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55731-55733]
[DOCID:fr23se05-11]
[OPP-2005-0238; FRL-7735-8]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: EPA is removing time-limited tolerance exemptions for several pesticide chemicals. These time-limited tolerance exemptions are being removed because they have expired and are obsolete, and to ensure that the regulatory listings of tolerance exemptions are properly updated. DATES: This final rule is effective on November 22, 2005.
ADDRESSES: EPA has established a docket for this action under Docket identification (ID) number OPP-2005-0238. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA., Monday through Friday, excluding legal holidays. The Docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Kathryn Boyle, Registration Division (7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-6304; fax number: (703) 305-0599; e-mail address: boyle.kathryn@....

Fenpropathrin; pesticide tolerance
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55740-55748]
[DOCID:fr23se05-13]
[OPP-2005-0133; FRL-7738-7]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes tolerances for residues of fenpropathrin in or on bushberry subgroup 13B; lingonberry; juneberry; salal; pea, succulent; and vegetable, fruiting, group 8. Interregional Research Project Number 4 (IR-4) requested these tolerances under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA).
DATES: This regulation is effective September 23, 2005. Objections and requests for hearings must be received on or before November 22, 2005. ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VI. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2005-0133. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Shaja R. Brothers, Registration Division (7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-3194; e-mail address: brothers.shaja@....

Kasugamycin; pesticide tolerance
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55748-55752]
[DOCID:fr23se05-14]
[OPP-2005-0017; FRL-7736-4]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes a tolerance forresidues of kasugamycin in or on fruiting vegetables, crop group 8. Arysta Lifescience North American Corporation (previously know as Arvesta Corporation), agent for Hokko Chemical Industry Corporation, requested this tolerance under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA). DATES: This regulation is effective September 23, 2005. Objections and requests for hearings must be received on or before November 22, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VI. of theSUPPLEMENTARY INFORMATION. EPA has established a docket for this action under Docket
identification (ID) number OPP-2005-0017. All documents in the docket are listed in the EDOCKET index athttp://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Mary L. Waller, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 308-9354; e-mail address: waller.mary@....

Pyriproxyfen; pesticide tolerance
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55733-55740]
[DOCID:fr23se05-12]
[OPP-2005-0246; FRL-7737-8]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes tolerances for residues of pyriproxyfen in or on grass, forage, fodder, and hay, group 17, forage; grass, forage, fodder, and hay, group 17, hay; vegetable, legume, group 6; onion, dry bulb; grape; strawberry; sapote, white; and citrus hybrids. Interregional Research Project Number 4 (IR-4) requested these tolerances under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA). DATES: This regulation is effective September 23, 2005. Objections and requests for hearings must be received on or before November 22, 2005. ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VI. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under docket identification (ID) number OPP-2005-0246. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805. FOR FURTHER INFORMATION CONTACT: Shaja R. Brothers, Registration Division (7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: 703-308-3194; e-mail address: brothers.shaja@....

Amicarbazone; pesticide tolerance
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55752-55761]
[DOCID:fr23se05-15]
[OPP-2005-0185; FRL-7736-3]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes tolerances for combined residues of amicarbazone and its metabolites in or on field corn and livestock commodities and indirect or inadvertent residues of amicarbazone and its metabolites in alfalfa, cotton, soybean and wheat. Arysta Lifescience North American Corporation (perviously known as Arvesta Corporation) requested this tolerance under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA).
DATES: This regulation is effective September 23, 2005. Objections and requests for hearings must be received on or before November 22, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VI. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2005-0185. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm.
[[Page 55753]]
119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Joanne I. Miller, Registration
Division (7505C), Office of Pesticide Programs, Environmental
Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-
0001; telephone number: (703) 305-6224; e-mail address: miller.joanne@....

Pyridaben; pesticide tolerance
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55761-55770]
[DOCID:fr23se05-16]
[OPP-2005-0267; FRL-7738-6]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes tolerances for residues of pyridaben in or on hop, dried cones; papaya; star apple; sapote, black; mango; sapodilla; sapote, mamey; canistel, fruit, stone, group 12; strawberry; and tomato. Interregional Research Project Number 4 (IR-4) requested these tolerances under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA). EPA is also deleting certain pyridaben tolerances that are no longer needed as result of this action.
DATES: This regulation is effective September 23, 2005. Objections and requests for hearings must be received on or before November 22, 2005. ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit VI. of the SUPPLEMENTARY INFORMATION. EPA has established a docket for this action under docket identification (ID) number OPP-2005-0267. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute. Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Barbara Madden, Registration Division
(7505C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-6463; e-mail address: madden.barbara@....

Malathion; revised risk assessments, notice of availability, and solicitation of risk reduction options
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55839-55842]
[DOCID:fr23se05-41]
ENVIRONMENTAL PROTECTION AGENCY [OPP-2004-0348; FRL-7733-5]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: This notice announces the availability of EPA's revised human health risk assessment and as well as the start of a 60-day comment period ecological risk assessment for the organophosphate pesticide malathion. A revised human health assessment on malathion was conducted to incorporate toxicity data which EPA received after 2000. Since no additional ecological data on malathion has been received after 2000, EPA's ecological risk characterization has remained unchanged. This notice also solicits information or data from stakeholders and interested parties to help refine the malathion risk assessment, and encourages parties to suggest risk management ideas or proposals to address the potential risks which have been identified. EPA is developing an Interim Reregistration Eligibility Decision (IRED) for malathion through the full, 6-Phase public participation process, which in this case includes reissuing the revised risk assessment for an additional Phase 5 public comment period. The Agency uses this process to involve the public in developing pesticide reregistration and tolerance reassessment decisions. Through these programs, EPA is ensuring that all pesticides meet current health and safety standards. DATES: Comments must be received on or before November 22, 2005.
ADDRESSES: Comments, identified by identificaiton (ID) number OPP-2004-0348, may be submitted electronically, by mail, or through hand delivery/courier. Follow the detailed instructions as provided in Unit I. of the SUPPLEMENTARY INFORMATION.
FOR FURTHER INFORMATION CONTACT: Tom Moriarty, Special Review and Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: (703) 305-5035; fax number: (703) 308-8005; e-mail address: moriarty.thomas@....

Pesticide reregistration performance measures and goals
September 23, 2005
[Federal Register: (Volume 70, Number 184)]
[Page 55842-55851]
[DOCID:fr23se05-42]
[OPP-2005-0013; FRL-7696-1]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Notice.
SUMMARY: This notice announces EPA's progress in meeting its performance measures and goals for pesticide reregistration during fiscal year 2004. The Federal Insecticide, Fungicide, and Rodenticide Act (FIFRA) requires EPA to publish information about EPA's annual achievements in this area. This notice discusses the integration of tolerance reassessment with the reregistration process, and describes the status of various regulatory activities associated with reregistration and tolerance reassessment. The notice gives total numbers of chemicals and products reregistered, tolerances reassessed, Data Call-Ins issued, and products registered under the ``fast-track'' provisions of FIFRA. Finally, this notice contains the schedule for completion of activities for specific chemicals during fiscal years 2005 through 2008.
DATES: This notice is not subject to a formal comment period. Nevertheless, EPA welcomes input from stakeholders and the general public. Written comments, identified by the docket ID number [OPP-2005-0013], should be received on or before November 22, 2005. ADDRESSES: Comments may be submitted by mail, electronically, or in person. Please follow the detailed instructions for each method as provided in Unit I. of the SUPPLEMENTARY INFORMATION section of this notice.
FOR FURTHER INFORMATION CONTACT: Carol P. Stangel, Special Review and
Reregistration Division (7508C), Office of Pesticide Programs, Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460; telephone: (703) 308-8007; e-mail:stangel.carol@....

#4144

From: Doug Powell <dpowell@...>
Date: Mon Sep 26, 2005 9:16 pm
Subject: Agnet Sept. 26/05

dpowell@...

how to subscribe

A project to remodel grape genes yields mostly outrage
September 26, 2005
The New York Times/Reuters
http://www.nytimes.com/2005/09/26/international/europe/26colmar.html?oref=login
COLMAR, France -- Behind six-foot fencing, watched by unblinking video eyes, and guarded by motion detectors that set off bright halogen lights and a silent police alarm in the event of nocturnal intruders, there lurks, according to this story, what some people in this gentle wine-making region consider an unholy alliance between the noble grape and "Frankenstem": 70 grapevines grafted onto genetically modified rootstocks.
The stories explain that the operation here by the National Institute for Agronomic Research is meant to demonstrate that transgenic plants can cure one of grape growing's most nettlesome ills: the fan-leaf virus, which turns leaves yellow and kills the flowers before they can form fruit, reducing vineyard yields. The virus is present in as many as a third of French vineyards.
Ren� Mur�, glaring behind large tortoise-shell-rimmed eyeglasses, at a nearby winery that his family has run since 1648, was quoted as saying, "We feel that we don't have the right to alter nature," adding that wine should be an expression of the land and that the tiny worms that carry the virus and even the virus itself are part of the complex and wondrous biology that makes for great wine.
Gene splicers argue that a transgenic answer is the only effective way to stop the virus, short of saturating the soil with pesticides to kill the worms that carry it, or tearing out infected vineyards and leaving the land fallow for 10 years.
The stories explain that Mo�t Chandon's scientists eventually won approval for a field test from the Ministry of Agriculture and quietly planted dozens of the gene-altered grapevines in 1996, only to rip them out three years later when the French press learned of the project.
Worried about tarnishing its image, the company turned over the genetic material to the National Institute for Agronomic Research, which has been working ever since to win over skeptical winemakers.
Olivier Lemaire, lead scientist on the project, was cited as saying winemakers worry that someone could steal the genetically modified grapevines and transplant them in the neighboring vineyards, "as a kind of bioterrorism."
Mr. Lemaire was further cited as saying the institute has also agreed to cut off all buds before they can develop into flowers and hus, the plants will not be used to produce wine. He emphasized that there was no exchange of DNA between the rootstock and the grapevine grafted onto it. There may, however, be an exchange of RNA, a nucleic acid present in all cells, and one of the things the scientists want to discover is whether the genetically modified rootstock will send virus-killing RNA into the grapevine, making the entire plant immune.
The scientists also created a test area to see if the transgenic rootstock caused the virus itself to mutate or if the worms migrated toward unprotected rootstocks planted in clean soil.
Scientist Jean Masson was quoted as saying, "The environmental risk is nil. We have taken all safety measures."
Pierre-Paul Humbrecht, a maker of wines, said was quoted as saying in his vineyard just a few km away from the open-air experiment that, "It makes me angry because this is imposed on everyone without us being informed about the risk. If there's a problem, it concerns us all. We fear for our vines."

Agnet Sept. 26/05

A project to remodel grape genes yields mostly outrage

Experiment on the pine family tree

Building a healthier bean

Malaysia to build three biodiesel plants fuelled by palm oil

Should Florida learn to live with canker?

DNA fingerprints for insects

Pesticides kill

Virus-resistant sugarcane tested

Natreon� canola oil - a solution towards a trans fat free Canada

Meet the weed world's Yankees

Experiment on the pine family tree
September 26, 2005
Arkansas Democrat-Gazette
Nancy Cole
In January, the El Dorado-based company, Anthony Forest, planted 30,000 loblolly pine seedlings � 10,000 each in its south Arkansas, north Louisiana and east Texas timberlands that were "genetically elite" seedlings developed by CellFor Inc., a Vancouver, Canada-based company that claims its trees will produce more and better wood, increasing harvestable yields by up to 33 percent. Formed in 1999, CellFor sold its first seedlings in 2003.
Steve Barham, Anthony Forest�s general manager of forestry, was cited as saying he plans to carefully monitor these seedlings, comparing them with others that were planted alongside them at the same time, adding, "If it�s not economically feasible, then we will make a decision after four or five years not to do that anymore."
The story explains that although most pine seedlings cost 3 to 4 cents each, CellFor�s seedlings cost about eight to 10 times as much because they are produced with the aid of proprietary technology.
Anthony Forest�s investment in elite seedlings would have been unheard of just a few years ago. But with 82,000 acres of timberland that provide about 15 percent of the logs used at the company�s two sawmills, in Urbana, Ark., and Atlanta, Texas, and two chip mills in Plain Dealing, La. and Troup, Texas, tree improvement � especially improvement gained through the use of biotechnology � is seen as one way to boost forest productivity.
Anthony Forest is not alone in its thinking. The May issue of the Southern Journal of Applied Forestry was devoted entirely to the issue of genetic impacts on the productivity of Southern pine forests.

Building a healthier bean
September 26, 2005
The Des Moines Register
Anne Fitzgerald
http://desmoinesregister.com/
A decade ago, crop seeds developed with the use of biotechnology were just beginning to hit the market but now, a new wave of crops, many of them engineered, is, according to this story, emerging that promises benefits to consumers.
Among those cited by industry experts, the next wave includes:
Sugar beets that produce fructans, a sweet-tasting type of sugar that is indigestible � a plus in weight management.
Soybeans containing low levels of linolenic acid, thereby eliminating the need for hydrogenation, a chemical process that increases soy oil's shelf-life but produces harmful trans-fatty acids.
Soybeans and other oilseed crops with increased levels of beneficial fatty acids, such as canola, which contains high levels of stearic acid.
White corn with higher levels of unsaturated fat.
Sunflowers with oil low in saturated fat but higher in oleic acid content.
Soybeans with increased sucrose content that taste better and are more easily digested.
Vegetables that ripen more slowly, allowing more time to travel from field to market.
The story explains that food companies seek better-tasting soybingredients, healthier whole grains and food additives that fight diabetes and other diseases, and to do so, they're forming partnerships with companies like Pioneer Hi-Bred International Inc., based in Des Moines, to develop seeds that produce crops for specific uses.
One of Pioneer's partners is General Mills Inc., the sixth-largest food company in the world. Marc Belton, senior vice president for worldwide health, brand and new business development at Minneapolis-based General Mills � whose brands include Pillsbury, Betty Crocker and Cheerios � was cited as saying the company has placed increased importance on producing foods that benefit consumers' health, adding, "We increasingly see opportunity in this area, whether it's around weight management or heart health."
Cargill Health Food Technologies, a division of grain giant Cargill Inc. in Minneapolis, focuses on developing food and dietary supplement ingredients that can help boost women's health and healthy hearts and joints. Cargill also makes products intended to help combat diabetes and obesity, including plant-derived phytosterols that are free of saturated fat and can be used in dietary supplements, beverages and food products, such as nondairy creamers.
DuPont, the Wilmington, Del., chemical and life science behemoth that owns Pioneer, has an alliance with General Mills to make heart-healthier snack foods and other products. Together, the companies have developed 8th Continent soy milk. The Solae Co., a St. Louis venture owned jointly by DuPont and Bunge Ltd., contracts with farmers to raise soybeans, then processes the beans and provides soy protein for production of the soy milk.
For Des Moines-based Pioneer, the trend toward "functional foods," or food products that include health-boosting ingredients, means growing demand for seed products that are tailored to specific end uses, such as more nutritional foods and more value-laden livestock feed.
Pioneer has 100 end-use accounts � grain processors, food manufacturers, livestock feed producers and other customers for whom the company develops seed corn hybrids and soybean varieties to grow crops for particular uses.
The story says that for swine producers, Pioneer researchers have developed seed corn hybrids that yield grain that is more completely digestible than conventional hybrids, resulting in reduced manure output by those animals
For ethanol producers, Pioneer has developed corn hybrids with elevated levels of starch, the main feedstuff used to make the fuel additive.
For food companies, Pioneer evaluates food-grade corn hybrids' ability to resist mold. The company also has designed white corn hybrids preferred by corn chip and tortilla makers.
Dozens of other specific-use crops are in the pipeline, and some are expected to hit the market in the next three to five years.

Malaysia to build three biodiesel plants fuelled by palm oil
September 26, 2005
Agence France Presse
KUALA LUMPUR - Malaysia was cited as announcing Monday it will build three plants to produce biodiesel from palm oil, as part of efforts to reduce its dependency on petroleum as oil prices continue to soar on the world market.
Plantation Industries and Commodities Minister Peter Chin Fah Kui was quoted as telling an international palm oil congress in Kuala Lumpur that, "Palm biodiesel is set to become a viable alternative to petroleum diesel" and that the Malaysian Palm Oil Board (MPOB) will "commence soon the construction of up to three biodiesel plants, each with annual capacity of 60,000 tonnes of biodiesel."
The story notes that Malaysian exported 12.5 million tonnes of the oil last year, worth some 8.0 billion dollars, accounting for 58 percent of global palm oil exports and 27 percent of the global oils and fats trade.

Should Florida learn to live with canker?
September 25, 2005
Knight Ridder/Tribune Business News
Susan Salisbury, The Palm Beach Post, Fla.
On Sept. 28, 1995, during a routine check for destructive Mediterranean fruit flies in a trap outside a house at Southwest 16th Street, Miami, a state agriculture worker spotted suspicious-looking lesions on the leaves of a nearby grapefruit tree. Louis Willio Francillon was familiar with the disease because he'd worked for the state's canker program in the 1980s.
The Florida Department of Agriculture lab in Gainesville confirmed that the blemish was indeed caused by canker, marking the third time in the 20th century that the bacterial disease had infested the state's citrus trees.
Since then, it's been nothing but heartache.
The story notes that as of this month, canker has spread to 24 of the state's 67 counties. More than 9 million fruit trees have been destroyed, or soon will be, in the state's quest to rid Florida of a plague for which there is no cure.
Most of those trees have been taken out of commercial citrus groves, including the prized Indian River grapefruit-growing region.
Florida Department of Agriculture spokesman Mark Fagan was cited as saying the citrus Canker Eradication Program has grown into the largest eradication effort ever mounted against an agricultural plant disease.
Craig Meyer, deputy commissioner of the state Department of Agriculture, was quoted as telling a canker task force meeting last week that, "We had no knowledge we were going to have to remove this amount of trees. We are not staffed to remove this amount. It has caught us unequipped," adding that on Friday, the CCEP will run out of money entirely; it's happened six or seven times before.
The story notes that last Thursday, the U.S. Senate passed an agriculture appropriations bill that contains $40 million for canker eradication, and there are requests on the state legislature's table for an additional $40 million.
Mac Turner, an Arcadia grower who has lost more than 140,000 trees to the canker fight, was quoted as saying, "If I go to a doctor who says I got something on my finger so he has to cut my whole arm off�I'm going to get another opinion."
State law requires the removal of all citrus trees within 1,900 feet of a tree with canker, meaning most trees taken out are healthy. Tim Gottwald, a USDA plant pathologist whose research created the rule, was cited as saying there isn't any science to support any other approach, adding, "There is no drop-in replacement for the 1,900-foot law. It would take three or four years to develop something else, and I don't think you want to wait that long."
Jim Graham, a UF soil microbiologist, has embarked on a series of "living with canker" presentations around the state, telling his grower audiences that canker's impact can be lessened with copper sprays, windbreaks, and the planting of resistant varieties, adding, "If we have to live with canker, we need to understand the science behind that. This is the beginning of the discussion, not the end."
Harmless to humans and animals, canker has cost taxpayers $510 million and brought emotional angst to the thousands of homeowners and hundreds of commercial growers who have had their trees taken in the name of stopping the disease.

DNA fingerprints for insects
September 26, 2005
ARS News Service
Agricultural Research Service, USDA
http://www.foodsafetynetwork.ca:16080/admin/www.ars.usda.gov/is/pr
Using genetic fingerprinting, Agricultural Research Service (ARS) scientists have developed a method to identify immature forms of beneficial insects that could help control the pesky Colorado potato beetle.
Scientists have difficulty identifying immature forms of beneficial predators because they look so different from adults�and most identification guides are based on adult forms.
Now scientists at the ARS Insect Biocontrol Laboratory in Beltsville, Md., have developed DNA fingerprinting tools that match the immature predators to adults that have been positively identified.
Led by entomologist and research leader Matthew Greenstone, the group first demonstrated that these techniques can be applied to agriculturally important spider and ground beetle species, in a paper published in the September 2005 issue of the journal Molecular Ecology.
These techniques will be of immediate value to scientists, whose findings will then be used by extension personnel and consultants to advise growers on how to preserve and foster the most important predatory species.
Biological control�the management of pests by killing them with beneficial organisms, like predatory and parasitic insects�is a major alternative to control with chemical pesticides. Spiders and predatory insects play a major role in biological control of insect pests. Understanding their role is hampered by the inability to identify their immature forms.
ARS is the U.S. Department of Agriculture's chief scientific research agency.

Pesticides kill
September 24, 2005
National Post
Gideon Forman, executive director, Canadian Association of Physicians for the Environment, Toronto, writes regarding, "Weed out this law," Lorne Hepworth, Sept. 13, to say that nowhere in this article is there a word about the new scientific research showing pesticides pose a threat to human health.
In April, 2004, the Ontario College of Family Physicians released the most comprehensive study in Canadian history on the relationship between pesticide use and illness. The study found links between these chemicals and brain cancer, prostate cancer, kidney cancer and pancreatic cancer; it also found associations between pesticide use and birth defects, fetal death and intrauterine growth retardation.
Most worrisome, it found that children exposed to lawn and garden herbicides were at increased risk for leukemia. How many more people have to get sick before we realize there are better ways to deal with dandelions?

Virus-resistant sugarcane tested
September 26, 2005
CropBiotech Net
http://www.isaaa.org/kc/
Sugarcane is an agronomically important crop which is also subject to a host of pathogens. Its high ploidy level also makes traditional breeding programs much harder to undertake, since they require cultivation of thousands of crosses, and eight to ten years of field testing to produce a commercial cultivar.
Genetic transformation of sugarcane is one of the few techniques available to increase yields and confer disease resistance to the crop. In view of this, R. A. Gilbert, of the University of Florida, and colleagues undertook the �Agronomic Evaluation of Sugarcane Lines Transformed for Resistance to Sugarcane mosaic virus Strain E.� Their research is documented in the latest issue of Crop Science.
Sugarcane Mosaic Virus (SCMV) is a lethal pathogen of sugarcane. In the study, researchers transformed a total of 386 plants with an untranslatable form of the SCMV strain E coat protein gene into cultivars CP 84-1198 and CP 80-1827. After field tests of several transformed lines, they found that transgenics derived from CP 84-1198 had significantly greater tonnes of sucrose per hectare (TSH) and significantly lower SCMV disease incidence than those from CP 80-1827. There were still variations amongst the crops tested, and researchers recommended more field tests for transgenic sugarcane to ensure that all plants would uniformly express the trait.
Subscribers to the journal can read the complete article at http://crop.scijournals.org/cgi/content/full/45/5/2060. Other readers can take a look at the abstract at http://crop.scijournals.org/cgi/content/abstract/45/5/2060.

Natreon� canola oil - a solution towards a trans fat free Canada
September 26, 2005
From a press release
OTTAWA - A new generation of canola oil developed by Dow AgroSciences is a growing solution to a healthier Canada. Trans fat free and low in saturated fat, Natreon� canola oil is a healthy alternative to partially hydrogenated oils currently used for restaurant frying and packaged foods... and it is available now. "The Canadian canola industry can supply the required quantity to replace all partially hydrogenated oil currently used in Canadian food within two years," states Jim Wispinski, Marketing Director for Dow AgroSciences. This message will certainly pique the interest of the Task Force on Trans Fats (TFTF), which intends to make recommendations this fall about eliminating or reducing processed trans fats in Canadian foods.
While consumers have reduced their total fat intake over the past 20 years, coronary heart disease remains Canada's number one killer today. Canada is one of the countries with the highest per capita consumption of trans fats in the world. Trans fatty acids are found mostly in foods made with partially hydrogenated oil. Examples include fried foods, baked goods and snack foods. The World Health Organization and Health Canada recommend limiting saturated and trans fats as much as possible to reduce the risk of heart disease.
Natreon canola oil is trans fat free and contains the lowest amount of saturated fat of any vegetable oil on the market. Natreon is abundant in "good" mono and polyunsaturated fats. It's natural stability makes it ideal for food service applications, such as frying, and for products that require extended shelf-life, such as baked goods and snack foods.
Dow AgroSciences took part in the June 2005 Task Force consultation where they presented Natreon canola oil as an ideal trans fat free alternative for restaurants and food manufacturers currently examining ways to comply with the coming recommendations. "Natreon provides greater than 70% reduction of trans and saturated fat compared to partially hydrogenated oils," added Wispinski. "We will continue to work with our oil processing partners and the food industry to develop trans fat free, low saturated fat foods because we believe Natreon canola oil will make a difference in improving the health of Canadians."
Natreon was developed in Canada and is being sold in Canada, the United States and Japan.

Meet the weed world's Yankees
September 26, 2005
Guelph Mercury
Owen Roberts
If you grow it�"it" being a field crop, such as corn or soybeans�they will come.
They are weeds.
And right behind them, or better yet, in front of them, will be a farmer, trying to stop them. Weeds are a natural phenomenon, a hardy, vibrant collection of what's come to be called noxious plants, trying to find their place in modern ecosystems. Farmers want to control them, because they appreciably reduce crops' productivity and quality.
People think of weeds as a problem mainly during a crop's early growth cycle, as they use up water and nutrients that would otherwise go to the crop. But they don't stop being a problem anytime during the growing season, including now, as harvest approaches. If they haven't been removed from a field, they can diminish the quality of the harvest and get in the way of some harvesting equipment.
To control weeds, farmers draw on experience, instinct and experts. And some of the best weed experts in North America are graduating from the Ontario Agricultural College at the University of Guelph.
In the summer, some of those students stuck their collective chins out at Penn State University's Southeast Research and Extension Center near Landisville, Pennsylvania, at the Northeastern Collegiate Weed Science Contest. There, mentored by coach and plant agriculture Prof. Clarence Swanton and Kris Mahoney, with help from research technicians Peter Smith and Rob Grohs, the undergraduates taught their American counterparts a lesson�again, for the second year in a row�in weed control, by winning the prestigious contest.
And for the first time, they also swept the top individual undergraduate awards.
The competition is significant. This annual contest provides an applied, educational experience for students studying weed science and agronomy at universities in Canada and the United States. Eight universities take part, including academic heavyweights such as Cornell University, Clemson, and this year's host, Penn State.
So, what do you do at a weed contest? First, you can't properly eliminate a weed unless you can name it. To that end, students participated in weed identification, as well as herbicide identification, problem solving, and sprayer calibration�making sure just the right amount of herbicide is applied.
The first-place Guelph weeds team members were Andrew Chisholm, Brian Gowan and Chrissie Schill. The second place team consisted of Phil Aitken, Jim Burns, and Gerard Pynenburg. Pynenburg, Burns and Gowan swept the top undergraduate awards, winning first, second and third, respectively. As well, Gowan received top marks in herbicide injury identification, as did Burns for sprayer calibration. Schill earned the highest marks for her efforts in problem solving.
Tim Dutt, president of the Northeastern Weed Science Society, called Guelph's teams "the New York Yankees of the Northeastern Weeds Contest." It turns out Guelph's weeds team has won this competition more times than any other university during the contest's 23-year history�Guelph teams have dominated the undergraduate division with 11 wins. The next closest team has four wins.
Why do we need graduate students who are at the top of the field when it comes to weeds? For one thing, it makes them better practitioners. Some of the graduates will go on to be farmers, and will be using herbicides regularly.
Others will work for companies that sell the products, and need to know them inside and out, for effectiveness and safety.
And in agriculture, like any sector, winning a Can-Am competition is a good resume builder.
"We may be a relatively small college compared to some, but we're producing international-scale agronomists," says coach Swanton.
Congratulations to the winners, and to the Ontario Agricultural College.
Owen Roberts teaches agricultural communications at the University of Guelph.

#4145

From: Doug Powell <dpowell@...>
Date: Wed Sep 28, 2005 4:19 am
Subject: Agnet Sept. 27/05

dpowell@...

how to subscribe

Will biotech wheat research be revived?
September 27, 2005
Knight Ridder/Tribune Business News
Mikkel Pates, Agweek Magazine
FARGO, N.D.�A Crop Biotechnology Update Conference in Fargo, N.D., last week was remarkable primarily because, according to this story, it brought together proponents and opponents of the technology that often aren't in one place.
The story says that the conference drew technology officials of the major companies and the organic producers who fear contamination of their non- GMO crops. Parts of the conference were attended by agricultural officials from several foreign countries who were in Fargo for a grain procurement seminar at the Northern Crops Institute.
Officials of three companies�Monsanto, Pioneer and Sygenta�offered brief updates about new crop traits being developed by their companies.
Among the traits on the horizon are those that would allow more efficient uptake of nitrogen for less expensive fertilization and pharmaceuticals, or better use for making fuel.
Paul Isakson, regional tech development manager for Monsanto and a native of the Mohall, N.D., area, was cited as saying his company's efforts now are concentrated on four crops�corn, soybeans, canola and cotton, and that drought tolerance, cold tolerance and nitrogen utilization are some of the primary opportunities.
Isakson was further cited as saying he predicts a release of biotech wheat into the market won't happen until U.S. agriculture takes a more unified approach and until major corporations drop their stance against certain biotech crops.
Estimates from the three officials indicate that it takes a biotechnology company about $80 million to $120 million in research and product support to bring a biotech crop to market.
Tom Frappier of Pioneer Hi-Bred International was cited as saying his company's entire research budget for biotech and conventional breeding is $340 million to $350 million per year.
The cost of getting a 1-bushel increase in yield has tripled in the past five years, Isakson says, through biotech tools, like using "molecular markers" to take a "chip off the seed" to know if a seed or plant contains the gene or DNA of interest.
The story notes that North Dakota State Rep. Mike Brandenburg, R-Edgeley, was one of the farmers in the group, urging the technology companies to continue to consider wheat and barley for their biotech. Duane Berglund, a North Dakota State University agronomist who hosted the conference, agreed with Brandenburg, who branded the opposition as primarily political, but opponents had more basic questions.
Todd Leake, a Larimore, N.D.-area farmer and GMO opponent asked whether U.S. universities could jeopardize their access to international genetic seed banks, if the universities enter into patent contracts with biotech companies who might patent crops from those seed banks. No one at the conference offered an answer.

Agnet Sept. 27/05

Will biotech wheat research be revived?

ICMR calls for mandatory labelling of GM foods

Biotechnology: A healthy catalyst

Deal to share GM papaya benefits likely

How petunias survive water deficiencies

Monsanto responds to news reports questioning patent situation on Roundup Ready soybeans in Brazil

Fear the reapers

Antibiotic resistance markers in GM plants not a risk to human health

Now in Spanish: farm-ready findings from Idaho scientists

BASF Canada inc. - New Headline� registrations expand disease control fungicide

Federal reports on climate change funding should be clearer and more complete

Monsanto company; availability of petition and environmental assessment for determination of nonregulated status for corn genetically engineered to express high lysine levels

ICGEB Biosafety -data SEPTEMBER 2005

ICMR calls for mandatory labelling of GM foods
September 27, 2005
The Financial Express
Ashok B Sharma
The Indian Council of Medical Research (ICMR) was cited as calling for mandatory labelling of genetically modified (GM) foods, saying that imported foods containing traces of genetically modified organisms (GMOs) should be tested for their safety in the labs in the country.
The report prepared under the leadership of ICMR director-general NK Ganguly has been submitted to the government. The recommendations of the report are being reviewed by the Central Committee on Food Safety (CCFS) for incorporation under the Prevention of Food Adulteration (PFA) Act and Rules.
The ICMR report focuses on issues of labelling, nutrition value, food safety and ethical values.

Biotechnology: A healthy catalyst
September 27, 2005
ezigrain
Biotechnology could be just the catalyst graingrowers need to crop more productively, without degrading their most important productive tool, the land.
Growers know they have to look after tomorrow�s natural resources today by maintaining soil fertility, using chemicals wisely and utilizing the biological advantages of rotation farming.
Biotechnology could help pave the way for producing crops that add to the land, rather than take away, and could even create health benefits for consumers.
Jim Peacock, President of the Australian Academy of Science, addressing the National Press Club, outlined his belief that in the future agriculture will increasingly be linked directly to matters of public health.
He stated that the diseases of our western societies are largely a consequence of lifestyle changes, including diet and that many diet related diseases, like diabetes, cardiovascular disease and colonic cancer, result largely from the way we live and can be helped by what we consume.
Dr Peacock said that changing our staple foods so that they helped guard against the onset of these diseases would make a significant contribution to reducing the $72.2 billion the Australian government annually spends on health.
Biotechnology can help us grow crops that use 86 per cent less chemical insecticides, which could directly benefit not only the health of the land but also the health of consumers.
It is possible to genetically modify cereal grains so that they will be of greater nutritional value and more closely meet our dietary requirements.
As the world�s population increases, we need to produce more food, but we need to produce it more reliably and with greater empathy for the natural environment.

Deal to share GM papaya benefits likely
September 27, 2005
Bangkok Post
Piyaporn Wongruang
The Agriculture Department will not, according to this story, hesitate to sign the planned benefit-sharing agreement over the co-invention of the genetically modified papaya and related inventions with a US foundation. Sophida Hemakhom, the department's legal affairs officer, was cited as saying the department had considered this thoroughly and viewed that the agreement would have no negative impacts on the country.
The department plans to sign a memorandum of understanding to share benefits in GM papaya and other related inventions with the Cornell Research Foundation, with which Thai researchers co-developed the papaya years ago.
The foundation has applied for patents to cover the method of growing the virus-resistant papaya as well as the discovery of the ringspot virus genes.
But experts said the virus are almost naturally common, and therefore should not be patented.
The experts also urged the department to protect other biological resources found in Thailand from being patented.

How petunias survive water deficiencies
September 27, 2005
Checkbiotech
Katharina Schoebi
When plants experience a drought, they produce special compounds, such as the amino acid proline. Recently, Japanese researchers found that petunias can better survive a drought when they contain the gene for a key enzyme in proline biosynthesis .
Water deficiency is a serious problem for agriculture, and drought tolerance has become a major issue of late. This is in part due to the increased attention that has been given to water conservation. The problem is still growing and enforcing a strong demand for generating new crop varieties with improved drought tolerance. Irrigated plants would benefit from a more efficient water use, and simultaneously also the economics of production would be improved.
Nowadays, genetic engineering offers the possibility to identify genes that render plants tolerant to drought. Various experiments revealed that drought activates a variety of metabolic and defense systems in plants, for example: the accumulation of sugars, the sugar substitute mannitol and the amino acid proline.
Of the three defense systems, the pathway for proline production is well-known, since a considerable amount of research has been done with it in the past. An enzyme called D1-pyrroline-5-carboxylate synthetase (P5CS) plays a key role in the production of proline. Past research revealed that transgenic tobacco (Nicotiana tabacum) and rice (Oryza sativa) plants overproducing P5CS synthesized more proline than untransformed plants, which helped them better tolerate too much, or a lack of water.
Noticing the ability of P5CS to help plants survive in drought conditions, Dr. Yoshiba from the Central Research Laboratory in Saitama, Japan, and his colleagues wondered whether P5CS from Arabidopsis thaliana (AtP5CS) and from Oryza sativa (OsP5CS) would display similar functions in a commercially important plant like the petunia (Petunia hybrida).
In order to help petunias produce more proline, the research group first introduced the AtP5CS and OsP5CS genes into petunias. Afterwards, they compared the growth and proline content of these plants with that of untransformed petunias under drought stress (without water at 25� Celsius).
The untransformed petunia plants showed only little or no growth in the absence of water, and they did not survive after rewatering. The proline concentration in these plants amounted to 60 percent of total amino acid content, whereas untransformed plants growing under normal condition did not produce proline.
The genetically engineered Petuniae hybridae, however, showed normal growth. Dr. Yoshiba�s team discovered that the proline content in these petunias was up to 3.5 times the content of untransformed plants growing under normal conditions.
The researchers could further observe that the higher proline content in the transformed petunias rendered them more tolerant to drought and that after rewatering, up to 53 percent of the plants were revived. Dr. Yoshiba and his colleagues therefore concluded that there must be a correlation between the survival rate and the proline accumulation in genetically modified petunias.
To investigate the influence of proline on plant growth, the researchers added some additional proline to young untransformed petunias. After the addition of proline, the plants showed clear stress symptoms: they accumulated about 100 times more proline, their root growth was retarded and their leaves became yellowish. The severity of these stress symptoms was directly correlated to the addition of proline.
Compared to previous experiments with Arabidopsis in Dr. Yoshiba�s lab, however, the proline content in the young untransformed Petunia hybrida was up to 18 times higher, which reduced root growth and leaf production. Thus, the researchers suggest that young untransformed petunias are hypersensitive to sudden increase in proline.
In contrast, adult transgenic petunias had a proline content as high as one percent of the total amino acids and did not show any stress symptoms. In adult transgenic tobacco plants, however, almost half of the total amino acid content was proline and the plants showed an enhanced drought tolerance.
From these results, the researchers suggest that the proportion of proline to the total amino acid content � rather than the concentration � is what influences the growth of petunias under drought conditions. In other words, when a plant constantly produces higher levels of proline it is more capable of surviving, when proline levels increase due to drought conditions.
Looking at the prospect of increasing proline amounts in other plants due to the success of this project, Dr. Yoshiba was cautious and explained, the ability for other plants to tolerate proline might depend on the plant species or the growth stages.
Dr. Yoshiba�s work provides a good corner stone for producing drought tolerant petunias through the use of AtP5CS and OsP5CS. By so doing, the increasing demand for water conservation can be met, while also providing florists with a better product. Most notably however is that Dr. Yoshibi�s work has laid the ground work for producing many other varieties of water-saving flowers and crops.
Katharina Schoebi is a biologist and Chief Science Writer for Checkbiotech. Contact her at katharina.schoebi@....
Yoshu Yoshiba et al. Effects of free proline accumulation in petunias under drought stress. Journal of Experimental Botany. (2005) 56, pp. 1975-1981
Link to the abstract: http://jxb.oxfordjournals.org/cgi/content/abstract/56/417/1975

Monsanto responds to news reports questioning patent situation on Roundup Ready soybeans in Brazil
September 27, 2005
Monsanto
ST. LOUIS - In response to news reports in the Brazilian media, Monsanto Company (NYSE: MON) said today that it has multiple patents on its Roundup Ready soybean technology and it is taking steps to have these patents clarified through the Brazilian patent law system.
In a news article published over the weekend, a competitor of Monsanto and a representative of the Brazilian Industrial Property Office called into question a specific article of the patent law which determines the length of time for which a company receives protection under Brazil patent law. Monsanto believes that the law is clear that one of the company's Roundup Ready soybean patents has patent protection until August 2007. In fact, Monsanto has already been granted an injunction regarding the interpretation of this patent which allows the company to continue to collect royalties on its Roundup Ready soybean technology.
Under the pipeline patent treatment of Brazil's Industrial Property Law, Monsanto's additional patents on the Roundup Ready soybean technology are valid through June 2011. The company is currently taking action to affirm the expiration dates of these patents, just as many other companies have successfully done since Brazil's patent laws were modernized.
As the original news article in O Estado de S. Paulo states, the company and its seed partners continue to amicably negotiate an appropriate method for charging royalties.
Monsanto Company is a leading global provider of technology-based solutions and agricultural products that improve farm productivity and food quality. For more information on Monsanto, see: www.monsanto.com .

Fear the reapers
September 27, 2005
Tech Central Station
Xavier Mera
Genetically modified organisms (GMOs) have a notoriously bad reputation in France. In such a hostile environment, some people have not hesitated to destroy the few authorized fields of genetically modified plants in the name of the precautionary principle.
This summer, three attacks occurred in the Puy-de-D�me department, and responsibility for some of them claimed by the Collectif des faucheurs volontaires (or, "the volunteer reapers"). The company Meristem, French leader in the development of medicines made from genetically modified plants, was the target of this last wave of anti-GMO violence, without much media coverage.
But one group that did object to the anti-GMO vandalism was the organization Defeating Cystic Fibrosis. It turns out that the plants destroyed were meant to be used to develop drugs to relieve secondary effects of cystic fibrosis and to produce anti-cancer antibodies.
First of all, this is an obvious illustration of the dangers of the precautionary principle. By focusing only on the possible risks of GMO production, this principle also forces us to ignore the costs of abandoning it. Every choice has a cost, even if it is guided by this principle. In this case it is the availability of such medicines and the income they would represent for their producers - which have to be abandoned if the naysayers have their way. This is what "precaution" means for patients and pharmaceutical manufacturers.
Obviously, GMO opponents refuse to be seen as neglecting the interests of patients. They claim that such interests do not require the production of genetically modified plants. They claim that alternative techniques exist and that the only reason why GMOs are chosen is for greater profit. They are probably right: most of the time there are various technologies available for reaching a same result, and the choice of one or the other is generally not based on humanitarian reasons. So what? What is so sinister about financial considerations?
When a cheaper technique is found for using the soil more productively, as is typically the case with GMOs, it is good news for consumers because competition, if we let it do its job, will bring the prices down. Producing more by spending less means a more profitable investment. When investors come to understand such an opportunity for making money, they tend to turn towards the sector concerned by choosing this technique, thus increasing the production and lowering the price of the product. The choice of technique is thus not unconnected to the well being of patients. As long as free competition works, it is such financial considerations that guarantee patients wider access to treatments.
What about risks linked to GMOs? Perhaps we might agree with a statement made by the "voluntary reapers" claiming that "no scientific or therapeutic reason can justify the use of farmers' fields as laboratory fodder". Then the group referred to the risk of genetically modified cornfields "contaminating" the neighboring crops. According to Meristem, their plants are sterile and do not expose the neighboring properties to a change in the nature of their production. Even if we imagine that such deterioration is possible, this does not lead directly to the conclusion that GMOs should be banned, contrary to critics' claims. In reality this argument has nothing to do with GMOs, but rather with trespassing on other people's property. Owners of genetically modified plants "contaminated" by neighboring fields could just as well use it. And it would have to be proved that such trespassing had occurred, unlike self-appointed "reapers" who do not wait before acting.
In fact, it is not necessary to ban GMOs to prevent farmers' fields being turned into laboratory fodder. Instead of resorting to vandalism, these reapers could fight for the government to take more seriously article 2 of the Declaration of the Rights of Man and of the Citizen, enshrining the right to own property. If acts of pollution like "contamination" of fields were considered by lawyers as what they really are, trespassing on private property, GMO producers would tend to settle far away from possible plaintiffs or would invest in means of protection, such as greenhouses. In any case, the possibility of legal proceedings would push investors to better estimate the real risk of GMOs. Defending farmers does not call for banning GMOs, and destroying plants can only put a halt to the process of discovery about the risks linked to them.

Antibiotic resistance markers in GM plants not a risk to human health
September 27, 2005
The Lancet
Antibiotic-resistance markers in genetically modified (GM) plants do not pose a substantial risk to human health, concludes a review article published in the October issue of The Lancet Infectious Diseases.
Antibiotic resistance marker genes are used as a tool to recognise the successful introduction into plant cells of a new gene with beneficial characteristics. The markers are coupled with the new gene, so by selecting those cells that express the resistance marker, the cells that have incorporated the gene of interest into their DNA can be identified. Plants derived from these cells neither contain nor produce antibiotics.
The issue of the safety of incorporating antibiotic-resistance markers into GM plants has been a matter of public debate since the early stages of their development. Concern has surrounded the possibility that antibiotic-resistance genes might be passed from GM plants to bacteria, thus creating bacteria that are resistant to antibiotics such as those used to treat common skin, ear, and eye infections.
In this review, authors Stephen Gillespie (University College, London) and Philippe Gay evaluate the scientific evidence regarding the impact of antibiotic-resistance markers on human health. They consider the biological barriers to the transfer of antibiotic-resistance markers into bacteria that cause disease in animals and humans, and the possible clinical consequences of this transfer.
The authors conclude that whereas there is no evidence that antibiotic resistance from GM crops is being transferred to bacteria, this does not exclude the possibility that it might occur. However, the evidence suggests that, if it occurs at all, the contribution to the burden of antibiotic resistance from GM plants is low, and is dwarfed by inappropriate prescribing of antibiotics in medical practice and their use as animal growth promoters in agriculture.
Professor Gillespie comments: ��antibiotic-resistance markers do not pose a substantial risk to human health because the contribution that recombinant bacteria might make - should the enormous barriers to transfer be overcome - is so small that any contribution to antibiotic resistance made by GM plants must be overwhelmed by the contribution made by antibiotic prescription in clinical practice.�

Now in Spanish: farm-ready findings from Idaho scientists
September 27, 2005
ARS News Service
Agricultural Research Service, USDA
Information about environmentally friendly ways to grow top-quality potatoes, sugarbeets and other crops on irrigated farmlands is available in publications from Agricultural Research Service experts in Idaho. Now the summaries, or abstracts, of more than 100 of these publications have been translated into Spanish to streamline use of these methods by Spanish-speaking farm owners, managers and workers in the United States and abroad.
The publications, written by ARS scientists specializing in soil science, agricultural engineering and plant disease at the agency's Northwest Irrigation and Soils Research Laboratory in Kimberly, Idaho, cover everything from determining the alfalfa-hay preferences of dairy cows to zapping erosion caused by irrigation water as it whooshes down furrows.
The abstracts are available online at:
http://www.nwisrl.ars.usda.gov/publist.shtml
ARS soil scientist Robert E. Sojka, who heads the Kimberly laboratory, started the "Publicaciones" project about a year ago. He did that in response to requests from growers who wanted help in communicating with their Spanish-speaking employees about how to mix a white, powdery compound called PAM (short for polyacrylamides) into irrigation water.
Sojka and colleagues at the Kimberly center pioneered the use of PAM to thwart erosion on irrigated fields. Today, PAM is combined with irrigation water on an estimated 1 million acres of U.S. farmlands and prevents erosion of millions of tons of soil every year.
University of Idaho graduate student Maria Barahona and soil scientist Ariel Sz�gi, with ARS in South Carolina, did the translations.
Plans call for translating several hundred more abstracts, working from the newer publications to previous ones that date back to the early 1960s.
ARS is the U.S. Department of Agriculture's chief in-house scientific research agency.

BASF Canada inc. - New Headline� registrations expand disease control fungicide
September 26, 2005
BASF Canada
TORONTO, Ont. � BASF Canada has received expanded minor use registrations for use of the fungicide HEADLINE. The new registrations, for both ground and aerial application, were supported by the Ontario Ministry of Agriculture, Food and Rural Affairs (OMAFRA), and cover the use of HEADLINE fungicide for control of frog eye leaf spot on soybeans, angular leaf spot on edible-podded legume vegetables, and mycosphaerella blight, rust and ascochyta blight on succulent shelled beans and peas.
�These registrations provide growers with important new uses for fungicides generally and HEADLINE specifically in the management of disease in their crops,� says Ron Taylor, Market and Business Development Manager with BASF in eastern Canada. �Diseases are a constant management challenge in many crops throughout the growing season. These registrations are a welcome advancement to help growers protect their crops and maximize their yield potential,� Taylor noted, adding that BASF is very appreciative of the continuous efforts made by OMAFRA in supporting these minor use registrations.
The diseases in question have the following characteristics:
Frog eye leaf spot can be recognized by small, gray spots with reddish brown borders on the upper leaves in mid to late August. In severe cases, frog eye leaf spot can cause premature leaf drop and spread to stems and pods. The fungus infects seed, and consequently, the seed coat of infected seeds turns gray.
Angular leaf spot is the result of spores of the fungus which can infect all aerial plant parts, including stems, petioles and pods, but symptoms are most recognizable on leaves. Leaf lesions usually are brown with a tan or silvery centre and confined to tissue between veins, which gives it an angular appearance.
Ascochyta blight can be a particularly damaging disease to peas. This disease (also known as Mycosphaerella blight) cause small, dark, irregular-shaped flecks on the leaves, stems and pods. Under continuous humid conditions the lesions grow creating a concentric ring pattern. Ascochyta blight may also cause a uniform yellowing of the leaves. This symptom moves from the bottom of the plant upward. Severely infected plants desiccate. In addition to the foliar symptoms, the blight may result in oblong, purplish-black lesions on the lower stem and hypocotyl.
HEADLINE is rainfast within one hour of application and should be applied at a rate of 0.4L - 0.6L of product per hectare. Applications should be made at the beginning of flowering or at the onset of symptoms for the more aggressive diseases. Up to two applications per year are permitted, with a 10 to 14 day application interval, particularly if conditions are favourable for disease development.
Always read and follow all label directions.

Federal reports on climate change funding should be clearer and more complete
August 2005
GAO
Federal funding for climate change increased from $2.4 billion in 1993 to $5.1 billion in 2004 (116 percent), as reported by OMB, or from $3.3 billion to $5.1 billion (55 percent) after adjusting for inflation. During this period, inflationadjusted funding increased for technology and science, but decreased for international assistance. The share for technology increased (36 to 56 percent), while the shares for science and international assistance decreased (56 to 39 percent and 9 to 5 percent, respectively). However, it is unclear whether funding changed as much as reported because modifications in the format and content of OMB reports limit the comparability of funding data over time. For example, OMB reported that it expanded the definitions of some accounts to include more activities, but did not specify how it changed the definitions. Also, while OMB�s totals for science funding were generally comparable to CCSP�s totals, the more detailed data in CCSP reports were difficult to compare over time because CCSP introduced new categorization methods without explaining how they related to the previous methods. OMB officials stated that changes in their reports were due, in part, to the short timeline for completing them, and that it has not been required to follow a consistent reporting format from one year to the next. The Director of CCSP said that its reports changed as the program evolved. GAO was unable to compare climate-related tax expenditures over time because OMB reported data on proposed, but not on existing tax expenditures. For example, while OMB reported no funding for existing climate-related tax expenditures in 2004, GAO identified four such tax expenditures in 2004, including revenue loss estimates of $330 million to develop certain renewable energy sources. OMB reported that 12 of the 14 agencies that funded climate change programs in 2004 increased such funding between 1993 and 2004, but unexplained changes in the reports� contents limit the comparability of data on funding by agency. GAO found that OMB reported funding for certain agencies in some years but not in others, without explanation. For example, OMB reported funding of $83 million for the Department of Defense in 2003, but did not list any such funding in prior reports. OMB told GAO that it relied on agency budget offices to submit accurate data.

Monsanto company; availability of petition and environmental assessment for determination of nonregulated status for corn genetically engineered to express high lysine levels
September 27, 2005
[Federal Register: (Volume 70, Number 186)]
[Page 56441-56443]
[DOCID:fr27se05-41]
[Docket No. 04-112-1]
AGENCY: Animal and Plant Health Inspection Service, USDA.
ACTION: Notice.
SUMMARY: We are advising the public that the Animal and Plant Health Inspection Service has received a petition from Monsanto Company, seeking a determination of nonregulated status for corn designated as transformation event LY038, which has been genetically engineered to express a lysine-insensitive dihydrodipicolinate synthase (cDHDPS) enzyme, which allows for the accumulation of higher levels of lysine in the germ of the seed. Corn-soybean meal based diets formulated for poultry and swine are characteristically deficient in lysine and require the addition of supplemental lysine for optimal animal growth and production. This corn product may provide an alternative to supplementation of feed with lysine. The petition has been submitted in accordance with our regulations [[Page 56442]]
concerning the introduction of certain genetically engineered organisms and products. In accordance with those regulations, we are soliciting public comments on whether this corn presents a plant pest risk. We are also making available for public comment an environmental assessment for the proposed determination of nonregulated status. DATES: We will consider all comments we receive on or before November 28, 2005.
ADDRESSES: You may submit comments by either of the following methods:
EDOCKET: Go to http://www.epa.gov/feddocket to submit or view public comments. Once you have entered EDOCKET, click on the ``View Open APHIS Dockets'' link to locate this document. Postal Mail/Commercial Delivery: Please send four copies of your comment (an original and three copies) to Docket No. 04-112-1, Regulatory Analysis and Development, PPD, APHIS, Station 3C71, 4700 River Road Unit 118, Riverdale, MD 20737-1238. Please state that your comment refers to Docket No. 04-112-1.
Reading Room: You may read the petition, the environmental assessment, and any comments that we receive on this docket in our reading room. The reading room is located in room 1141 of the USDA South Building, 14th Street and Independence Avenue, SW., Washington, DC. Normal reading room hours are 8 a.m. to 4:30 p.m., Monday through Friday, except holidays. To be sure someone is there to help you, please call (202) 690-2817 before coming.
FOR FURTHER INFORMATION CONTACT: Dr. Levis Handley, Biotechnology Regulatory Services, APHIS, 4700 River Road Unit 147, Riverdale, MD 20737-1236; (301) 734-5721. To obtain copies of the petition or the environmental assessment (EA), contact Ms. Ingrid Berlanger at (301)
734-4885; e-mail: ingrid.e.berlanger@.... The petition and
the EA are also available on the Internet at http://www.aphis.usda.gov/brs/aphisdocs/04_22901p.pdf and http://www.aphis.usda.gov/brs/
is.usda.gov/brs/

#4146

From: Doug Powell <dpowell@...>
Date: Wed Sep 28, 2005 3:27 pm
Subject: Agnet Sept. 28/05

dpowell@...

how to subscribe

Biotechnology debate must remain science-based, says EU Commissioner
September 28, 2005
CORDIS News
The EU Commissioner for Enterprise and Industry, G�nter Verheugen, has reiterated the need for an open debate on the benefits of biotechnology and the ethical questions surrounding it, but insisted that such a dialogue must remain science-based.
Mr Verheugen was outlining the Commission's biotech policy at a high level roundtable organised by the European association for bioindustries, EuropaBio. He said that if Europe is to compete with the US and other emerging challengers, then knowledge-based sectors, including biotechnology, would have to be at the forefront of the Commission's policies.
'It is my objective to ensure that we create the conditions so that Europe becomes the natural home for biotechnological innovation,' said Mr Verheugen. He went on to outline the areas where the Commission would concentrate its efforts in order to achieve this goal.
Support for innovation and the general science base are 'critical issues' for the Commission, but equally important is making sure that innovations result in applications that generate revenues. The new Competitiveness and Innovation Programme (CIP) is designed to do precisely that, said Mr Verheugen, by developing the innovative capacity of enterprise and industry.
The worrying trend of pharmaceuticals actors relocating their research and development (R&D) activities outside Europe was also highlighted by Mr Verheugen as an area for action. 'We must not underestimate this widening gap. Losing R&D in life sciences is going to have major social and economic consequences for Europe,' he said.
What is needed is an overall strategy for biotechnology, said the Commissioner, and fortunately for the EU it already exists. The Commission's Biotechnology Strategy, published in 2002, lays the groundwork for Europe's catch-up efforts and covers all fields of biotech - green, white and red. Mr Verheugen acknowledged the need to address societal concerns concerning biotechnology, however, and said that the Commission would launch a debate as part of the mid-term review of the strategy in 2006.
'The debate must, however, remain science based, and we must take a balanced view on matters of concern, such as GMOs, and avoid taking extreme positions. Clarity and knowledge will help to lower emotional prejudices,' he said, before highlighting the potential of genetically modified organisms to provide better crop yields, increased sustainability and better food and feed quality.
'However, we all know that public attitudes as well as Member States' positions hamper the development in this area. [...] Europe has to make its mind up whether it wants to use the full potential of green biotech to become competitive vis-�-vis countries like the USA, Canada, Australia, China and India,' the Commissioner argued.
'By keeping Europe at the cutting edge of biotechnology research, we will [...] contribute to the more general goals of creating more highly-qualified and well-paid jobs, boost economic growth and improve our terms of trade. Let's be clear: it will not be an easy task to achieve this [but] I am convinced we are able to face the challenge and come out successful,' Mr Verheugen concluded.

Agnet Sept. 28/05

Biotechnology debate must remain science-based, says EU Commissioner

Canada must make biotechnology choices

Enact laws on GMOs

GM crop impact 'lasts two years'

Banning the foot and mouth disease virus soon with a promising vaccine

Board continues GMO debate

Calif. bill would prevent local biotech bans

ZFS, Monsanto team up to grow healthier soybeans

Little difference in gene-altered potatoes

Advance may help mobilize more wasps against grape pest

The new look of temptation: With apple season in full swing, plant breeders near Montreal are excited about a new hybrid that doesn't discolour when cut

Rehydration; Exemption from the requirement of a tolerance

SCFCAH - phytopharmaceuticals

Canada must make biotechnology choices
September 28, 2005
From a press release
Canada needs to be poised to take advantage of the socio-economic potential of biotechnology, according a report released today by The Conference Board of Canada.
"Canada needs to make biotechnology a strategic priority," said Trefor Munn-Venn, author of the report. "Canadian biotechnology firms are generally small and undercapitalized, and they struggle to attract the scientific and managerial talent critical to success."
"Biotechnology is a global industry, so Canadian companies must vie for talent, investors and ideas on a worldwide scale. Competing nations are investing heavily in biotechnology to dominate market niches. Canada needs to step up its efforts to realize the benefits of this platform technology,
building on our considerable areas of strength." Biotechnology can be applied to many economic and social sectors-it can improve our ability to: treat debilitating diseases, clean up the environment, produce new goods and services, and compete internationally.
An evidence-based analysis of Canada's current biotechnology industry,
the Conference Board report raises policy questions for industry, the academic community and government.
The report, Biotechnology in Canada: A Technology Platform for Growth, is available at www.conferenceboard.ca . Its release coincides with National Biotechnology Week 2005 ( www.biotech.ca/imagenenation ) from Sept. 26 to Sept. 30, 2005.

Enact laws on GMOs
September 28, 2005
East African Standard
A meeting of experts on Genetically Modified Organisms opened in Nairobi yesterday, with, according to this story, a call to make laws and regulations to govern research and use of such foods.
The story says that opinion is split worldwide on whether genetically modified foods are beneficial to humankind. Although arguments for or against GMOs usually generate more heat than light, it is true that these foods could be the panacea to Africa�s perennial food shortage and poverty. Even some of the strongest critics of GMOs such as the World Health Organisation have recently softened their stand, saying they can bring benefits to both farmers and consumers.
However, each country has its unique needs, which must be assessed before rushing to embrace practices that have been rejected elsewhere. Only recently, Kenya suspended field trials on genetically modified maize after a major anomaly was discovered in a move aimed at stopping further abuse of procedures. This action underscores the dangers that exist in a lawless research scenario.
That is why we ask that laws and regulations governing research and use of GMOs be taken seriously. As a country, we must tread carefully to ensure consumers are protected from harmful foods.

GM crop impact 'lasts two years'
September 28, 2005
BBC News
Richard Black
A follow-up to the UK's major trial of genetically modified crops, the Farm Scale Evaluations, finds that impacts on wildlife can, according to this story, persist for two years.
The original trial found that spring GM rape and sugar beet were harsher than their conventional equivalents in the short term, while GM maize was better.
The new study shows the same pattern at two years for rape and maize.
The British government has welcomed the findings, which it says "provide important information" on GM crops.
Les Firbank, of the Centre for Ecology and Hydrology in Lancaster, the FSE project co-ordinator, was quoted as saying, "The new study confirms our impression of what would happen when we released the initial results. We did expect the differences to persist, and I don't think it will affect any decision on approving GM crops."
This follow-up, published in the Royal Society's journal Biology Letters, did not look at insects and birds as the initial study had done.
Instead, it confined itself to monitoring the weed seedbank - the number and diversity of weed seeds left in the soil, which will be food for insects and birds.

Banning the foot and mouth disease virus soon with a promising vaccine
September 28, 2005
Checkbiotech
Silke Luetzelschab
Researchers from Buenos Aires recently succeeded in developing a prototype vaccine for the Foot and Mouth Disease Virus in genetically modified plants.
In many cases, the development of vaccines in transgenic plants is a highly efficient, inexpensive, and also environmentally friendly way to produce a vaccine when compared to conventional methods. Due to the reduced production costs, low, middle and high income countries stand to profit.
Edible vaccines which are produced by molecular farming also offer the advantages of oral administration instead of injection, plus they are more stable and offer the possibility of dry freezing. This is another big advantage for developing countries where refrigerators are too expensive, or often not available.
So far vaccines for six infectious diseases (Hepatitis B, Diarrhoea, Norwalk virus, Rabies, Measles, respiratory syncytial virus) have been successfully expressed in plants and administered orally to animals or humans. A seventh may not be far off.
The Foot and Mouth Disease (FMD) virus causes a disease which affects milk and meat producing domestic animals. The 2001 FMD epidemic in the UK cost about 9 billion US$ and about 6 million animals had to be slaughtered. There are vaccines for the FMD virus available today, but the production of the vaccine is expensive and carries a risk to animals.
That is why the work of Dr. M.J. Dus Santos and her team at the Instituto de Virolog�a S.Rivenson in Buenos Aires, Argentina is so important. Their goal was to find a FMD vaccine that could be expressed in an edible plant.
Vaccines developed in transgenic plants carry no risk to the animals and can be much less expensive. Dr. Santos� work is unique, because previous vaccines have concentrated on using simple, recognizable structures. But now for the first time Dr. Dus Santos and her team were able to produce a complex antigenic structure (vaccines are composed of antigens, which lead to an antibody reaction of our immune system) of a protein, called FMDV VP1 polyprotein, from the FMD virus. For their experiments they produced transgenic alfalfa plants expressing the FMDV VP1 polyprotein with the help of Agrobacterium tumefaciens, a microbe which is used to transfer genetic material into plants.
Once Dr. Dus Santos was able to harvest enough of the transgenic alfalfa varieties, the vaccine component was separated and used in initial studies with mice. After administering mice the oral vaccine, Dr. Dus Santos laboratory showed that all the mice produced a good immune response, which normally indicates protection against future infections. To test this, Dr. Dus Santos team infected the mice with the FMD virus. Much to their content, none of the mice became infected.
From the development of a vaccine against the FMD virus in transgenic plants all countries with an important animal farming economy stand to profit. Of course it has a very high importance for a developing country, such as Argentina, where livestock is an important asset to the its economy. Dr. Dus Santos� new vaccine should soon become an inexpensive and safe method to protect Argentina�s and the world�s livestock against FMD.
Silke Luetzelschwab is a Molecular Biologist and a Scientific Writer for Checkbiotech.
Maria J. Dus Santos et al. Development of transgenic alfalfa plants containing the foot and mouth disease virus structural polyprotein gene P1 and its utilization as an experimental immunogen. Vaccine, 23 (2005), p. 1838-1843
http://dx.doi.org/10.1016/j.vaccine.2004.11.014

Board continues GMO debate
September 28, 2005
Record-Bee.com
John Jensen
http://www.record-bee.com/
LAKEPORT�The debate before the Lake County, Califfornia, board of supervisors over planting genetically modified Roundup-resistant alfalfa in the county was, according to this story, continued for the second time Tuesday.
The topic, continued to Oct. 11, was last heard by supervisors on Aug. 23.
The debate will continue into October to give supervisors time to study the issue further after more documentary evidence was provided than they could absorb during Tuesday's meeting.
The story says that the three-and-a-half-hour public hearing served only to raise more questions than it answered regarding a proposed 30-month moratorium on the glyphosate-resistant hay.
The extended discussion altered the positions of neither moratorium proponents nor opponents, although many had a good deal to say on the topic. The two groups sat on either side of the chamber with opponents outnumbered by those who favored a sit-back-and-wait strategy regarding the alfalfa.
The hotly contested issue has drawn battle lines with both groups providing volumes of evidence to support their respective cases.
Opponents of the moratorium, including the Farm Bureau, fear it will be the first step toward a full ban on genetically modified organisms in Lake County.
Toni Scully, owner of Scully Packing, was cited as imploring the supervisors to deny the moratorium on the grounds that farmers should have the right to use any technology they can to compete, adding, "Our entire livelihood is tied up in the agricultural environment of this county."
Moratorium proponents specifically, the Coalition for Responsible Agriculture, who authored the proposed ordinance, were cited as saying they are working to create a 30-month period in which the seed won't be planted in Lake County, which will allow farmers and officials to observe how the hay does in other areas and decide whether or not to allow it to be grown here.
Pear farmer Phil Murphy spoke to the board late in the day to point out that the moratorium addressed strictly one product and did not address any others.
He cautioned the board to take time to carefully consider the ramifications of the decision and the evidence provided. Murphy pointed out that in spite of seemingly careful study, plant life can surprise people by adapting

Calif. bill would prevent local biotech bans
September 28, 2005
Heartland Institute
Michael Coulter
http://www.heartland.org/
A bill currently before the California legislature would, according to this story, promote a consistent statewide agricultural policy by preventing individual counties from banning the growing of genetically modified crops.
The story explains that the bill, introduced June 29, is being led through the state Senate by Dean Florez, a Democrat who represents parts of Kern, Tulare, and Fresno counties. Those three are among California's top six counties for agricultural production, according to the Measure of California Agriculture 2000, produced by the University of California Agricultural Issues Center.
In 2004, six California counties voted on whether to ban the growing of genetically modified foods. Voters in Mendocino passed the ban in March 2004, while voters in Marin and Trinity passed bans in November 2004. The Florez bill would overturn those votes. Voters in Butte, San Luis Obispo, and Humboldt counties rejected similar bans.
Sonoma County is set to vote on a similar measure this fall.
Alex Avery, director of research at the Center for Global Food Issues, was quoted as saying, "There is no impact at this time from California counties banning genetically modified foods, because those counties have little or no genetically modified agriculture."
Gregory Conko, director of food safety policy at the Competitive Enterprise Institute, was quoted as saying, "Where real agriculture is practiced, as in Humboldt, San Luis Obispo, and Butte Counties in California, these proposed bans have been voted down overwhelmingly. The areas that have enacted bans, including Marin and Mendocino counties, are ones where no real agriculture takes place, as in Marin, or where the agriculture that does take place is a highly specialized boutique industry that at least for the next few years would not benefit from using biotech crops, such as Mendocino's wine production, since there are no commercially approved biotech grape varieties available. Thus, in the near term, the bans are functionally just symbolic and largely meaningless. Nevertheless, they are a matter of concern, if for no other reason than their symbolic message that some Americans can be as reactionary and Luddite as the Europeans have been."
The story adds that the Florez bill has garnered broad support from agriculture groups, including the Farm Bureau, California Association of Winegrape Growers, and California Cattlemen's Association. Farm groups say the bans would create a competitive disadvantage with other parts of the world.

ZFS, Monsanto team up to grow healthier soybeans
September 28, 2005
mlive.com
Ron Cammel
http://www.mlive.com/
Zeeland Farm Services Inc., a Michigan-based farm supplier and food processor, has, according to this story, contracted with agricultural giant Monsanto Co. to process a newly developed soybean that does not require hydrogenation.
Starting Jan. 1, the U.S. Food and Drug Administration will require nutrition labels to specify content of trans fatty acid, also called trans fat.
Food manufacturers want to prevent trans fat from turning away consumers and have looked for alternatives to hydrogenation, said Chris Cook of Monsanto.
Over the past 10 years, Monsanto developed a soybean, Vistive, with low linolenic acid, reducing the need for hydrogenation, he said.
The 150-employee Zeeland Farm Services will contract with several growers in Michigan to grow the beans in 2006 and return the crop to Zeeland Farm Services for processing into oil and feed.
Zeeland Farm Services already supplies food makers with a low-linolenic soybean oil from a bean developed by Ohio State University, company spokesperson Norma Knoll said.
Monsanto's bean, however, also includes the genetically engineered Roundup Ready trait, which reduces weeds in fields.
The Ohio State bean is helping ZFS satisfy manufacturers' demand for nonhydrogenated products before the Jan. 1 deadline, but Visitive should be a more cost-effective solution, Knoll said.
Monsanto spent "millions of dollars" to develop the low-linolenic trait in Vistive through conventional breeding, starting with genetically engineered crops, Cook said.
ZFS, which could have the soybean growing on 25,000 acres next year, is the only Michigan company to contract for the product. Monsanto expects 500,000 acres of Vistive to be grown in 2006 nationally, after a limited trial this year.

Little difference in gene-altered potatoes
September 28, 2005
M&C Science Nature
http://science.monstersandcritics.com/
POTSDAM, Germany�Scientists in Potsdam, Germany, and Cardiff, England, were cited as saying there`s little difference between genetically produced potatoes and conventional varieties, and that the two types of potatoes only differ in substances intentionally incorporated with gene technology.
The conclusion was reached by scientists at the Max Planck Institute of Molecular Plant Physiology in Potsdam, Germany, and colleagues from the University of Wales in England.
The scientists compared genetically modified Desiree potatoes with five conventional varieties.
The main results of the study showed substances in the Agria, Desiree, Granola, Linda and Solara varieties exhibit a surprising range of variation. The genetically modified lines from the Desiree variety lie within the same of range of variation except for a higher content of inulin polysaccharides. There was no evidence of any new, unexpected substances.
Two different genes for the formation of insulin sugars were introduced into the GM potatoes since polysaccharides have a beneficial effect on human intestinal flora.
The analyses of nearly 2,800 potato specimens was financed by British Food Standards Agency.
The study is detailed in the Sept. 19 online early edition of the Proceedings of the National Academy of Sciences.

Advance may help mobilize more wasps against grape pest
September 28, 2005
ARS News Service
Agricultural Research Service, USDA
www.ars.usda.gov/is/pr
Gonatocerus wasps don't bug people. But these tiny parasites can put a real hurt on glassy-winged sharpshooters, leaf-hopping insects that pose a disease threat to California grape vineyards.
Now, an experimental method of refrigerating parasitized sharpshooter eggs for up to 60 days may improve the artificial rearing of Gonatocerus wasps for field release as biological control agents. Agricultural Research Service (ARS) entomologist Roger Leopold is investigating the insect-storage method along with Marion Harris and Wenlong Chen, both with North Dakota State University in Fargo.
Gonatocerus wasp releases are part of a multipronged approach California has taken to keep sharpshooters from spreading the bacterium Xylella fastidiosa, which causes Pierce's disease in grapevines and other host plants. Gonatocerus wasps reproduce by laying their eggs inside those of sharpshooters. After hatching, Gonatocerus larvae eat their egg hosts, develop and emerge 10 to 12 days later as adult wasps. In California, Gonatocerus' spring emergence lags behind sharpshooters', so fewer are around to parasitize the pests' eggs. Fall attacks, though, can inflict sharpshooter losses of up to 90 percent.
Releasing insectary-reared wasps can help close that gap, but the practice is expensive and time-consuming since live plants and sharpshooter eggs must be used. Refrigerated storage could cut production costs and furnish more time to amass the wasps for spring releases, notes Leopold, with ARS' Biosciences Research Laboratory, Fargo.
In studies there with G. asmeadi and G. triguttatus wasps, Leopold's team stored parasitized sharpshooter eggs for 30 to 60 days by adjusting three temperature settings in a stair-step fashion. Under one such regimen�starting and ending with 4.5 and 7.5 degrees Celsius, respectively�the wasp emergence rate was 60 percent. Importantly, their health and longevity were similar to wasps from untreated eggs, reports Leopold.
His team plans on submitting a scientific paper describing the results, including wasp-emergence rates from dead eggs. Leopold and Chen will also present their work at the Pierce's Disease Research Symposium in San Diego this December.
ARS is the U.S. Department of Agriculture's chief in-house scientific research agency.

The new look of temptation: With apple season in full swing, plant breeders near Montreal are excited about a new hybrid that doesn't discolour when cut
September 28, 2005
The Montreal Gazette
Julian Armstrong
Canadian federal plant breeders are developing an array of new apples such as a McIntosh that stays fresh in your refrigerator for nine months, a yellow apple like the French Reinette and better than the Golden Russet, and a new Gala specifically geared to Quebec weather?
One new apple is generating considerable excitement because the fruit's crisp, white flesh and the discovery that it stays that way when cut open.
There's no need to drizzle cut surfaces of this apple with lemon juice to stop it from discolouring. What's more, since it does not fall from the tree but stays on the branch when the weather turns cold, it's a natural for ice cider.
Inventor, Shahrohk Khanizadeh, a fruit breeder at the St. Jean sur Richelieu orchard run by Agriculture Canada, was cited as saying that about eight years ago, he was cross-breeding various types of apple trees in search of fruit that resists disease and has better than usual shelf life, adding, "But then I cut one of these apples and, a half-hour later, noticed that it stayed white. I couldn't believe it."
The new apple, created using traditional cross-breeding methods, came from crossing two varieties of apple trees: the Jonamac, a New York state variety widely grown in Quebec; and the Linda, an old Ontario variety originally bred in about 1930 but no longer in commercial production.
The story goes on to say that licensing procedures for the new apple are holding up sales of the trees to growers. The necessary Canadian Plant Breeder's Right has been acquired, and a U.S. patent has been applied for, but it may be some months before the U.S. patent is granted.

Rehydration; Exemption from the requirement of a tolerance
September 28, 2005
[Federal Register: (Volume 70, Number 187)]
[Page 56569-56576]
[DOCID:fr28se05-5]
[OPP-2005-0244; FRL-773-5]
AGENCY: Environmental Protection Agency (EPA).
ACTION: Final rule.
SUMMARY: This regulation establishes an exemption from the requirement of a tolerance for residues of the Muscodor albus (M. albus) QST 20799 and the volatiles produced on its rehydration on all food commodities when applied or used for all agricultural applications, including seed, propagule and post harvest treatments. This action is in response to a pesticide petition submitted to EPA under the Federal Food, Drug, and Cosmetic Act (FFDCA), as amended by the Food Quality Protection Act of 1996 (FQPA), requesting an exemption from the requirement of a tolerance. This regulation eliminates the need to establish a maximum permissible level for residues of M. albus QST 20799 and the volatiles produced on its rehydration.
DATES: This regulation is effective September 28, 2005. Objections and requests for hearings must be received on or before November 28, 2005.
ADDRESSES: To submit a written objection or hearing request follow the detailed instructions as provided in Unit IX. of the SUPPLEMENTARY
INFORMATION. EPA has established a docket for this action under Docket identification (ID) number OPP-2005-0244. All documents in the docket are listed in the EDOCKET index at http://www.epa.gov/edocket. Although listed in the index, some information is not publicly available, i.e., CBI or other information whose disclosure is restricted by statute.
Certain other material, such as copyrighted material, is not placed on the Internet and will be publicly available only in hard copy form. Publicly available docket materials are available either electronically in EDOCKET or in hard copy at the Public Information and Records Integrity Branch (PIRIB), Rm. 119, Crystal Mall 2, 1801 S. Bell St., Arlington, VA. This docket facility is open from 8:30 a.m. to 4 p.m., Monday through Friday, excluding legal holidays. The docket telephone number is (703) 305-5805.
FOR FURTHER INFORMATION CONTACT: Shanaz Bacchus, Biopesticides and Pollution Prevention Division (7511C), Environmental Protection Agency, 1200 Pennsylvania Ave., NW., Washington, DC 20460-0001; telephone number: 703-308-8097; e-mail address: bacchus.shanaz@....

SCFCAH - phytopharmaceuticals
September 28, 2005
European Commission, Health and Consumer Protection
The complete document of the following is available at:
http://europa.eu.int/comm/food/committees/regulatory/scfcah/phytopharmaceuticals/index_en.htm
Summary record of 23 September 2005

#4147

From: Doug Powell <dpowell@...>
Date: Thu Sep 29, 2005 10:50 pm
Subject: Agnet Sept. 29/05

dpowell@...

how to subscribe

China GMO rice unlikely this year-scientists
September 29, 2005
Reuters
BEIJING - A state newspaper was cited as saying on Thursday that China, the world's biggest producer and consumer of rice, is close to approving a genetically modified version of the staple, but scientists denied any breakthrough was imminent.
The China Daily was cited as saying the State Agricultural GMO Crop Biosafety Committee, the technical body which evaluates GM rice for research and marketing, would likely meet in November and that China could become the first country to approve large-scale planting of GMO rice.
Jikun Huang, a pro-GMO scientist at the China Academy of Sciences, was quoted as telling Reuters that, "The government is serious about examining GMO rice safety issues or the impact on the environment and they want to make sure everything is fine. Given this situation, I personally think it (a decision in November) is not very likely."

Agnet Sept. 29/05

China GMO rice unlikely this year-scientists

Biotechnology debate must remain science-based, says Verheugen

Midwest will be next biotech hotbed

GEAC�s Bt crop approval challenged

Healthy calves through edible vaccines

Agbiotech: The ethical dimension

Gibberellin Insensitive Dwarf1 encodes a soluble receptor for gibberellin

Pesticides found in nearly a third of British food and drink products

New soybean resists nematodes and pathogens

Croplife Canada plants the seeds to grow Canada

Institute to focus on changes, challenges in agri-food industry

The American Phytopathological Society announces 2005 Awards

Standing committee community plant variety rights (SCPVR)

Regulatory Committees : Standing Committee on Plant Health (SCPH)

Food and Veterinary Office - Inspection reports

Standing Committee on Seeds and Propagating Material of Agriculture, Horticulture and Forestry (SCSP)

Biotechnology debate must remain science-based, says Verheugen
September 29, 2005
Cordis News
http://dbs.cordis.lu/
The EU Commissioner for Enterprise and Industry, G�nter Verheugen, has reiterated the need for an open debate on the benefits of biotechnology and the ethical questions surrounding it, but insisted that such a dialogue must remain science-based. Mr Verheugen was outlining the Commission's biotech policy at a high level roundtable organised by the European association for bioindustries, EuropaBio. He said that if Europe is to compete with the US and other emerging challengers, then knowledge-based sectors, including biotechnology, would have to be at the forefront of the Commission's policies. 'It is my objective to ensure that we create the conditions so that Europe becomes the natural home for biotechnological innovation,' said Mr Verheugen. He went on to outline the areas where the Commission would concentrate its efforts in order to achieve this goal. Support for innovation and the general science base are 'critical issues' for the Commission, but equally important is making sure that innovations result in applications that generate revenues. The new Competitiveness and Innovation Programme (CIP) is designed to do precisely that, said Mr Verheugen, by developing the innovative capacity of enterprise and industry. The worrying trend of pharmaceuticals actors relocating their research and development (R&D) activities outside Europe was also highlighted by Mr Verheugen as an area for action. 'We must not underestimate this widening gap. Losing R&D in life sciences is going to have major social and economic consequences for Europe ,' he said. What is needed is an overall strategy for biotechnology, said the Commissioner, and fortunately for the EU it already exists. The Commission's Biotechnology Strategy, published in 2002, lays the groundwork for Europe 's catch-up efforts and covers all fields of biotech - green, white and red. Mr Verheugen acknowledged the need to address societal concerns concerning biotechnology, however, and said that the Commission would launch a debate as part of the mid-term review of the strategy in 2006. 'The debate must, however, remain science based, and we must take a balanced view on matters of concern, such as GMOs, and avoid taking extreme positions. Clarity and knowledge will help to lower emotional prejudices,' he said, before highlighting the potential of genetically modified organisms to provide better crop yields, increased sustainability and better food and feed quality. 'However, we all know that public attitudes as well as Member States' positions hamper the development in this area. [...] Europe has to make its mind up whether it wants to use the full potential of green biotech to become competitive vis-�-vis countries like the USA, Canada, Australia, China and India,' the Commissioner argued. 'By keeping Europe at the cutting edge of biotechnology research, we will [...] contribute to the more general goals of creating more highly-qualified and well-paid jobs, boost economic growth and improve our terms of trade. Let's be clear: it will not be an easy task to achieve this [but] I am convinced we are able to face the challenge and come out successful,' Mr Verheugen concluded.

Midwest will be next biotech hotbed
September 29, 2005
From a press release
CHICAGO - �The Midwest�s biotechnology parts are greater than its whole right now,� said G. Steven Burrill, CEO of Burrill Company, a San Francisco based global leader in life sciences whose principal activities are in Venture Capital, Merchant Banking and Media. �The Midwest is not the first place people think of when considering centers of biotechnology excellence (most of the biotech activity is concentrated on the East and West coasts) but it�s really more of an awareness issue than it is a fact issue,� said Burrill.
�The Midwest is broadly very involved in the life sciences industry�medical devices, diagnostics, biopharmaceuticals, agricultural technology and industrial biotechnology all thrive. The region is home to literally hundreds of life sciences companies ... and medical devices in particular is one of its fastest growing sectors,� Burrill added.
�While it is difficult to get an accurate picture of the true biotechnology industry in the Midwest because every state classifies life science companies in different ways, there is plenty of ongoing activity: Economic and political leaders in the Midwest have targeted the life sciences as an engine of growth, and several Mid-western states have established specific funds to invest in the life sciences. The Midwest is home to life science industry leaders such as Abbott Laboratories, Archer Daniels Midland, Baxter, Cargill, Dow AgroSciences, Eli Lilly 3M, Guidant, Medtronic, GE Medical, Monsanto, and Procter Gamble. A group of world-class academic research institutions is helping to fuel innovation: the Big 10 universities all enjoy nationally recognized research programs. Over 300 dedicated biotechnology companies already exist in the Midwest - representing 21% of total US biotech companies (approximately 1400) 12 public biotech (3% of US total) Leading Midwest biotech players (public or private) include: Aastrom Biosciences; Advanced Life Sciences; BioSante Pharmaceuticals; Genomic Solutions; IDEXX Corp.; MGI Pharma; Neopharm; Northfield Labs; Third Wave Technologies. The $1 billion Michigan Life Sciences Corridor (MLSC) has become a catalyst for the industry, producing collaborations between academic and commercial sectors Medical Alley is a 350-mile-long corridor in Minnesota that is the location of thousands of companies and institutions in the medical field. The medical device industry is one of the Midwest �s unique strengths, and a field that is quickly attracting capital investments from some of the nation�s leading VC firms. The University of Wisconsin and the University of Illinois Urbana- Champaign are extremely strong in agricultural biotechnology. They support research in both plant and animal applications that are dedicated to improving yield and quality of products, and they house a number of germ plasm collections. More than one third of the agricultural biotechnology companies in the United States are located in the Midwest Nutraceuticals, industrial biotech and bioenergy/biofuels will have significant potential given the region�s strong agricultural base. The University of Minnesota , the Mayo Clinic, and the state of Minnesota have created the Minnesota Partnership for Biotechnology and Medical Genomics. Wisconsin is investing up to $750 million, including more than $500 million in new facilities and direct research support for scientists at UW-Madison, especially in stem cells. James Thomson and his collaborators in 1998, the University of Wisconsin � Madison has been a leader in this exciting area. Chicago boasts some of the leading research and medical institutions in the United States : the University of Chicago and Northwestern University , Argonne National Laboratory, University of Illinois- Chicago , Loyola Medical School , Finch University-Chicago Medical School, and the Fermi National Accelerator Lab (operating the world�s highest energy particle accelerator). Argonne operates the $20 billion advanced photon source, a key tool for protein and proteomics research. �The Midwest has the ability to build on its existing strengths especially in the areas of agricultural biotech and in the convergence of the medical device, diagnostic and therapeutic companies. It is clear that the predicted record attendance of over 25,000 registrants that will be attending BIO 2006 in Chicago in April will be pleasantly surprised at the wealth of opportunity that the region does have,� Burrill noted. �The event will also have a catalytic effect on the Midwest �parts� helping bind the industry into a cohesive whole. But the availability of venture capital is a necessary component for the Midwest to become a biotechnology powerhouse,� added Burrill. �Growing a regional center of excellence in biotechnology that will be internationally competitive requires commitment, collaboration of research institutions (e.g. the Big 10 universities), venture capitalists and the financial community, big pharma, diagnostic, device and healthcare focused companies, politicians that provide a stable and supportive tax, financial and regulatory environment, and a long-term perspective. The Midwest is well positioned in all these areas, with its large, world-class companies in both medicine and agriculture, top-tier research institutions generating a steady stream of innovation, and a culture that�s beginning to encourage development of exciting new biotechnology companies,� Burrill concluded.
http://www.burrillandco.com

GEAC�s Bt crop approval challenged
September 29, 2005
The Financial Express
http://www.financialexpress.com/
NEW DELHI - The controversy over the approval of 13 new varieties of Bt cotton is, according to this story, far from over. The Delhi-based NGO, Gene Campaign has written to the Genetic Engineering Approval Committee (GEAC) challenging the approval of 13 new varieties of Bt cotton under section 19 (b) of Environment Protection Act. Gene Campaign has planned to file a public interest litigation in case the GEAC fails to act on its complaint. It has demanded a full fledged enquiry on all aspects of Bt cotton through an independent multi-stakeholder body. Addressing a press conference in Capital on Wednesday, the Gene Campaign convenor, Dr Suman Sahai alleged: �The GEAC had the data about failure of Bt cotton. Several NGOs and farmers� organisations, through their reports had brought it to the notice of the GEAC. The scientists at the Nagpur-based Central Cotton Research Institute under the leadership of Dr KR Kranthi found that Bt cotton was not effective in India and that the resistance power of Bt gene to targeted pests declined after 110 days. These data was already available before and later published in the Current Science in July 25, 2005 .�

Healthy calves through edible vaccines
September 29, 2005
Checkbiotech
Katharina Schoebi
In the future, genetically engineered alfalfa plants containing a protein from a pathogen could be used for as production and delivery systems of edible vaccines. In response to an effective vaccine, the body�s immune system is stimulated by foreign proteins (or their fragments), which on their own do not cause disease. These so-called immunogenically active antigens can be produced by genetically modified plants, which can then be used for the production of vaccines. Plants furthermore provide the possibility for oral delivery by including them in the diet � an application that is especially relevant for pathogens that invade through oral routes. An example of a pathogen that invades its host through oral routes is the rotavirus group of viruses. Rotaviruses cause severe acute gastroenteritis in numerous mammalian species throughout the world. One economically important mammal that is affected by rotavirus infections is a newborn calve. Calves are susceptible to rotavirus infection during their first weeks of life. Immunization of these animals before exposure to the pathogen is very difficult. Mother cows, vaccinated against rotavirus however, produce antibodies in their colostrum (a fluid in the breasts that nourishes the baby until the breast milk becomes available) and their milk and pass them to their suckling newborns, an event known as passive protection. Passive protection conferred by a mother�s milk is thus the main protective mechanism against rotavirus infection in calves. Since vaccination by syringes is relatively costly and not easy to conduct, researchers all over the world are looking for alternative vaccination methods. The ideal vaccine might target a small 24 amino acid fragment (eBRV4) from the rotavirus protein VP4. The eBRV4 fragment allows rotaviruses to adhere and then enter the outermost cell layer in the gut, referred to as the epithelial cell layer. When eBRV4 fragments were injected into mice, they were found bound to epithelial cells and also induced the production of antibodies that blocked the rotavirus from infecting the epithelial cells. With these facts in mind, Dr. Manuel Borca from the Instituto de Virologia in Buenos Aires in Argentina and his research team have now developed an antigen based on genetically engineered eBRV4. For this purpose, the researchers genetically engineered alfalfa plants so that they produced the immunogenically active antigen. Dr. Borca and his colleagues recently published their results in the Journal of General Virology. In their experiments, the researchers immunized female mice by feeding them fresh transgenic alfalfa leaves, or by administrating extracts from the leaves into the mice�s abdominal cavity. Irrespective of the method of immunization, the researchers observed the induction of a rotavirus-specific antibody response in all mice � a major success for Dr. Borca. A second major result was that immunization of female mice - by both the intraperitoneal or oral route � induced the secretion of protective antibodies in the female�s mammary glands. These antibodies were then passed to the female�s offspring through colostrum and milk and as a result, suckling newborns had antibody levels comparable to those of their mothers. To determine if the antibody response of the pups would protect them against a rotavirus attack, Dr. Borca and his team orally infected the newborns with the virus and observed them over a 24 hour period. The results showed that more than 70 percent of pups were protected against rotaviruses. The researchers did their experiments with mice, but only experiments with cattle will show, if oral vaccines against Bovine Rotavirus are also effective in cows. The complexity of the cow�s rumen in comparison to a mouse�s digestive tract is one possible obstacle. �The ruminal system could certainly destroy all antigenic structures expressed in the plant, so the monogastric model of mice perhaps is not representing what would happen in the bovine,� Dr. Borca explained. Furthermore, the used antigen eBRV4 is just a small part of the virus and thus, it would be very risky to say that it is going to efficiently protect calves against the virulent challenge. �The eBRV4 model in mice is just that: a model to demonstrate the feasibility of using plant as expression vectors and use them as edible immunogens.� With the continued success of Dr Borca�s research and similar research projects from other laboratories, transgenic plants could become a very attractive alternative in animal health, because they could be used as both a production and delivery system for oral vaccines. And since plants can be grown cost-efficiently in large quantities, they may represent an alternative to conventional vaccine production systems. Dr. Borca also told Checkbiotech, �We have published the expression of different antigens in other plant systems such as, Arabidopsis and potatoes, with variable results. Now, we are working on the expression of other viral antigens such as BVDV (Bovine Viral Diarrhea Virus). We are currently producing the transgenic plants.� Katharina Schoebi is a biologist and Chief Science Writer for Checkbiotech. Contact her at katharina.schoebi@... . Manuel Borca et al. Protective lactogenic immunity conferred by an edible peptide vaccine to Bovine Rotavirus produced in transgenic plants. Journal of General Virology (2004) 85, pp. 1825-1832 Link to the abstract: http://vir.sgmjournals.org/cgi/content/abstract/85/7/1825

Gibberellin Insensitive Dwarf1 encodes a soluble receptor for gibberellin
September 29, 2005
Nature 437, 693-698
Miyako Ueguchi-Tanaka1,8, Motoyuki Ashikari1,8, Masatoshi Nakajima2,8, Hironori Itoh1, Etsuko Katoh3, Masatomo Kobayashi4, Teh-y
Abstract
Gibberellins (GAs) are phytohormones that are essential for many developmental processes in plants. It has been postulated that plants have both membrane-bound and soluble GA receptors; however, no GA receptors have yet been identified. Here we report the isolation and characterization of a new GA-insensitive dwarf mutant of rice, gid1. The GID1 gene encodes an unknown protein with similarity to the hormone-sensitive lipases, and we observed preferential localization of a GID1-green fluorescent protein (GFP) signal in nuclei. Recombinant glutathione S-transferase (GST)-GID1 had a high affinity only for biologically active GAs, whereas mutated GST-GID1 corresponding to three gid1 alleles had no GA-binding affinity. The dissociation constant for GA4 was estimated to be around 10-7 M, enough to account for the GA dependency of shoot elongation. Moreover, GID1 bound to SLR1, a rice DELLA protein, in a GA-dependent manner in yeast cells. GID1 overexpression resulted in a GA-hypersensitive phenotype. Together, our results indicate that GID1 is a soluble receptor mediating GA signalling in rice.
1. Bioscience and Biotechnology Center, Nagoya University, Nagoya 464-8601, Japan
2. Department of Applied Biological Chemistry, The University of Tokyo, Tokyo 113-8657, Japan
3. Department of Biochemistry, National Institute of Agrobiological Sciences, Tsukuba 305-8602, Japan
4. BioResources Center, Riken, Tsukuba 305-0074, Japan
5. Institute of Botany Academia, Sinica, Taipei 11529, Taiwan
6. Biotechnology Research Center, The University of Tokyo, Tokyo 113-8657, Japan
7. �Present address: Institute of Biotechnology, Central Taiwan University of Science and Technology, Taichung 406, Taiwan
8. *These authors contributed equally to this work

Pesticides found in nearly a third of British food and drink products
September 29, 2005
Agence France Presse
LONDON - The Pesticide Residues Committee 2004 study was cited as finding that traces of pesticide were found in 31 percent of the 3,854 British food and drink products tested by the government, though there were few cases of a serious risk to health.
Only 42 products, or about one percent of the total, contained residues above the legal limit. In cases in which the food may have posed a health risk, "there could have been a small risk of mild, reversible health effects" if the food had been eaten without preparation, the report says.
Doctor Ian Brown, chairman of the Pesticide Residues Committee, was cited as saying the results of the survey were reassuring, adding, "People should not be concerned by very low pesticide residues in our food. Our findings indicate that food suppliers are ensuring a high rate of compliance with legislation relating to use of pesticides and maximum residue levels."
The range of products tested included fruits, vegetables, meat, bread and drink from 24 cities across the United Kingdom.

New soybean resists nematodes and pathogens
September 29, 2005
ARS News Service
Agricultural Research Service, USDA
http://www.ars.USDA.gov/is/pr
High seed yield and unique resistance to nematodes and several diseases are the key qualities of new soybean lines developed by the Agricultural Research Service (ARS) and the Tennessee Agricultural Experiment Station in Knoxville.
The release of soybean lines JTN-5303 and JTN-5503 was announced today in Jackson , Tenn. , during a ceremony hosted jointly by ARS and the experiment station.
According to Prakash R. Arelli, a geneticist at the ARS Nematology Research Unit in Jackson , the new lines have broad resistance to multiple races of soybean cyst nematode (SCN). This is the most destructive soybean pest in the United States , causing an annual estimated loss of $1.1 billion.
JTN-5303 is a cross between the cultivars Caviness and Anand, while JTN-5503 is a cross between Fowler and Manokin. Traditional breeding techniques and marker-assisted selection were used to track resistance genes. Both lines have yields significantly higher than the popular cultivars Hartwig, Fowler and Anand, and have Hartwig-type resistance to widespread nematode populations.
Both lines were also selected for resistance to several fungal pathogens, including sudden death syndrome, stem canker, and frogeye leaf spot, with moderate resistance to charcoal rot. Previous lines have never had this unique combination of resistance to both SCN and pathogens.
The new releases are in Maturity Group V. Maturity groups are used to designate which varieties are best suited for production in specific geographic regions. The new lines are well adapted to production in the Mid South.
Arelli developed the new lines with Vince Pantalone and Fred Allen, geneticists at the University of Tennessee . They were assisted by ARS scientists Lawrence Young, Arelli's research leader, and Alemu Mengistu, a soybean pathologist.
These lines are expected to be ideal choices for breeders for use as parents in developing cultivars in early maturity groups that reduce soybean yield losses and reduce the need for pesticides. ARS is the U.S. Department of Agriculture's chief scientific research agency.

Croplife Canada plants the seeds to grow Canada
September 29, 2005
From a press release
TORONTO - CropLife Canada put a spotlight on plant science technology and on its role fostering innovation in Canadian agriculture, at the 53rd Annual Conference held in Niagara Falls , September 20-23. "To remain competitive, agriculture needs innovation to take root in Canada ," said Lorne Hepworth, President of CropLife Canada . "This annual conference brought together our members, stakeholders and government partners to share information and opportunities to facilitate innovation." The list of distinguished speakers included keynote speaker, Dr. Bjorn Lomborg, the 'sceptical environmentalist'. Dr. Lomborg is an adjunct professor of the Copenhagen business school, who challenged public understanding of global challenges in the areas of human health and the environment and discussed prioritization of these challenge to facilitate positive change. Dr. Lomborg stressed the need to targeting our limited resources into combating HIV/AIDS, malnutrition and malaria while securing free trade and better agricultural technologies. Other speakers focused on issues relating to food growth, production, distribution and regulation. Dr. David Bell, Professor of Agriculture and Business at Harvard business school, spoke about trends in global food production and distribution, while Annalisa King, Senior Vice-President of Vertical Co-ordination at Maple Leaf Foods Inc., provided insight on emerging trends in consumer behaviour and the power of innovation. Understanding current trends and consumer thinking are vital to realizing Canada 's true potential as a global leader in innovation and crop protection technologies. The first day of the conference concluded with an enlightening panel discussion on plant biotechnology, which looked back at 10 years of success and looked forward to future opportunities and challenges in agricultural biotechnology. Speakers highlighted the many possibilities for the future of plant biotechnology, including alleviating poverty, along with new innovations designed to provide new products to consumers and to help farmers become more competitive in a world marketplace. CropLife Canada 's conference continued on the second day with experts from the agri-food industry, government and growers associations speaking about areas of innovation in their particular fields. Ga�tan Lussier, Chairman of the Board of the Canadian Agri-Food Policy Institute highlighted the actions needed to help Canadian farmers compete and reinvent itself for future markets. Dr. Karen Dodds, Executive Director, Pest Management Regulatory Agency (PMRA) provided her perspective and vision for a new PMRA. The future was the topic of presentations by Barbara Isman, President, Canola Council of Canada and Christine Moran, Executive Director, Grain Growers of Canada who explored new directions for Canada and the agriculture industry. They presented their views on how to ensure Canadian agriculture is competitive in international markets both now and in the future. Summaries of all of the speaker's presentations will be made available in the near future on CropLife Canada 's website which can be found at www.croplife.ca .

Institute to focus on changes, challenges in agri-food industry
September 29, 2005
Institute of Agri-Food Policy Innovation
The University of Guelph and the Ontario Ministry of Agriculture, Food and Rural Affairs (OMAFRA) have created a new policy institute aimed at helping the province�s agri-food sector meet changing and future needs. �The agri-food industry is changing at an incredible pace, and policy is hard pressed to keep up,� said Dave Sparling, a professor in U of G�s Department of Agricultural Economics and Business and executive director of the Institute of Agri-Food Policy Innovation. �Our goal is to provide long-term, impartial thinking on the future role of the industry. The institute will tackle some of today�s big issues, but focus on looking ahead to future policy needs so that we have the most successful industry possible,� he said. Sparling will work with an eight-member board of directors who are leaders in industry, government and academia and have a wide range of expertise in the farming, agribusiness, food, rural and consumer sectors. The board will be chaired by Craig Pearson, dean of U of G�s Ontario Agricultural College . Prof. John Fitzgibbon, director of the School of Environmental Design and Rural Development, is also a member. A strategic review conducted by OAC, the University and Ontario�s agriculture, food and rural communities revealed a desire for the college to take a leading role in the development of forward-looking policies. As well, OMAFRA and U of G have a long history of working together and fully understand the benefits of strong partnerships, Pearson said. �The creation of this institute will bring independent advice, a global perspective and thinking �outside the box� to the policy debate,� Pearson said. �It is the natural next step towards a vital, internationally-competitive industry.�

The American Phytopathological Society announces 2005 Awards
September 29, 2005
The American Phytopathological Society
St. Paul , Minn. - The American Phytopathological Society (APS) is pleased to announce its 2005 award recipients. These awards were presented at the APS Annual Meeting, August 2005, in Austin , Texas .
APS grants the Fellow designation to current members in recognition of distinguished contributions to plant pathology or to the Society. The nine members named Fellows in the Society were: Carol L. Bender, Oklahoma State University; Raghaven Charudattan, University of Florida-Gainesville; Jacqueline Fletcher, Oklahoma State University; Christopher A. Gilligan, University of Cambridge; Walter Friedrich Otto Marasas, South Africa Medical Research Council, Tygerberg, South Africa; Bruce McDonald, Swiss Federal Institute of Technology, Zurich, Switzerland; Robert A. Owens, USDA Plant Virology Laboratory, Beltsville, MD; Gail Lynn Schumann, Marquette University; Xiao-Bing Yang, Iowa State University.
Melodie Putnam , Oregon State University, was presented the Excellence in Extension Award. This award recognizes excellence in extension plant pathology.
Caitilyn Allen, University of Wisconsin-Madison, received the Excellence in Teaching Award. This award recognizes excellence in teaching plant pathology.
The International Service Award was presented James R. Steadman, University of Nebraska-Lincoln. This award honors outstanding contributions to plant pathology by APS members for a country other than his or her own.
The Ruth Allen Award for Innovative Research was presented Andrew Otis Jackson, University of California-Berkeley and Thomas Jack Morris, University of Nebraska . This award honors individuals who have made an innovative research contribution that has changed, or has the potential to change, the direction of work in any field of plant pathology.
Thomas J. Wolpert, Oregon State University , received the Noel T. Keen Award for Research in Molecular Plant Pathology. This award recognizes individuals who have made outstanding contributions in host-pathogen interactions, plant pathogens or plant-associated microbes, molecular biology of disease development, or defense mechanisms.
The Syngenta Award went to James R. Alfano, University of Nebraska-Lincoln. Syngenta gives this award to an APS member for an outstanding recent contribution to teaching, research, or extension in plant pathology.
Full descriptions of each of the awardees are available at www.apsnet.org/members/awards/2005Awardees.asp. The American Phytopathological Society (APS) is a non-profit, professional scientific organization dedicated to the study and control of plant disease with 5,000 members worldwide.

Standing committee community plant variety rights (SCPVR)
September 29, 2005
European Commission, Health and Consumer Protection
The complete document of the following is available at:
http://europa.eu.int/comm/food/committees/regulatory/scpvr/index_en.htm
Agenda of the meeting of 14 October 2005

Regulatory Committees : Standing Committee on Plant Health (SCPH)
September 29, 2005
European Commission, Health and Consumer Protection
The complete document of the following is available at:
http://europa.eu.int/comm/food/fs/rc/scph/index_en.html
Agenda of the meeting of 29-30 September 2005

Food and Veterinary Office - Inspection reports
September 29, 2005
European Commission, Health and Consumer Protection
The complete document of the following is available at:
http://europa.eu.int/comm/food/fvo/ir_search_en.cfm?stype=insp_nbr&showResults=Y&REP_INSPECTION_REF=7571/2005
ES Spain - Plant passport system

Standing Committee on Seeds and Propagating Material of Agriculture, Horticulture and Forestry (SCSP)
September 29, 2005
European Commission, Health and Consumer Protection
The complete document of the following is available at:
http://europa.eu.int/comm/food/fs/rc/scsp/index_en.html
Agenda of the meeting of 4 October, 13-14 October and 17 October 2005 (3)

#4148

From: Doug Powell <dpowell@...>
Date: Fri Sep 30, 2005 8:22 pm
Subject: Agnet Sept. 30/05

dpowell@...

how to subscribe

Genetically engineered plants called no threat to human health
September 30, 2005
MedPage Today
Katrina Woznicki
LONDON �Fear that genetically modified foods containing so-called antibiotic-resistance marker genes would increase antibiotic resistance in humans is unfounded, according to a literature review by British scientists.
Known by some critics as �Frankenstein foods,� genetically modified foods have been eyed as a potential risk to human health because they contain microbial DNA.
In plant technology, antibiotic-resistance marker genes, bits of DNA, are coupled with a new desirable gene and the package is then injected into the plant�s cells, the British researchers explained in their report published in The Lancet.
The marker gene is used to help track the successful (or failed) introduction of the new desirable gene, which is designed to boost the plant�s defenses against environmental threats.
Plants derived from these cells neither contain nor produce antibiotics, the researchers explained. Because only cells that contain the antibiotic-resistance marker can survive exposure to an antibiotic (in the lab), scientists can be sure the surviving plant also contains the injected advantageous gene.
Critics� concerns are that antibiotic-resistant marker genes from these organisms will be passed from the plant to receptive bacteria and ultimately create mutated resistant microbes.
But Stephen H. Gillespie, Ph.D., a professor of medical microbiology at University College London here, said there is no evidence to indicate these markers pose any significant risk. Any recombinant bacteria, he explained, would have to cross several major hurdles during the transfer process, be incorporated into a host, and then be transmitted. Even if the markers accomplished all that, their risk would be minimal at best, he said.
�The contribution that recombinant bacteria might make-should the enormous barriers to transfer be overcome-is so small that its effect would be completely overwhelmed by the effect of resistance that arises through inappropriate (antibiotic) prescribing in medical practice, transmission of mobile genetic elements between bacteria colonizing patients, and hospital environments,� Drs. Gillespie and Philippe B. Gay, also a professor at University College London, wrote.
However, they warned that despite the lack of current evidence, the possibility remains. Scientists should look for alternatives and proceed with caution, they said.
The authors came to this conclusion after conducting a review of their own personal files, searches on PubMed, and references from relevant articles. In their review article, they described the many major obstacles these markers would have to overcome.
For starters, conditions must be ideal for these antibiotic resistant markers to make the transition to a new bacterial host. The DNA must not be totally degraded, and there must be a physical encounter between the DNA fragments and the recipient host organism, Dr. Gillespie said.
The outcomes for these antibiotic resistant markers �in genetically modified plants depends on the gene flow in the resistance reservoirs connecting the fields where these plants grow and the bacteria that could be altered to resistance and be transferred to human beings,� the authors wrote.
The environment in which these markers exist is also highly competitive, the authors explained. �Antibiotic-resistance markers are only a small proportion of the overall DNA available for transformation,� they explained .
The marker gene must also overcome the physiological disadvantage of acquiring a piece of foreign DNA-the gene with which the marker is coupled�probably in conditions where the new gene does not yet provide a selective advantage, the authors said.
The authors noted that there is evidence that fragments of DNA, long enough to encode an antibiotic resistance mechanism, have been found in the gastrointestinal tracts of mice. Despite this evidence, there are so far no signs recombination is taking place in these environments. Still, Drs. Gillespie and Gay said they wouldn�t rule out the possibility.
Should any new antibiotic-resistant organisms emerge, they would still face the human medical environment, including hospitals and antibiotic use, the authors said.
�Any contribution to antibiotic resistance made by genetically modified plants must be overwhelmed by the contribution made by antibiotic prescription in clinical practice,� the authors wrote. Particularly in hospitals where �bacteria are exposed to a multiplicity of antibiotic agents and selection pressure is at its highest.�
The authors concluded that �plants modified genetically have tremendous potential to improve human nutrition.� Although the public health cost of these improvements has been questioned, they added, the evidence shows the risks remain very low.
Primary The Lancet Infectious Diseases Source reference: Gay P. and Gillespie S., �Antibiotic resistance markers in genetically modified plants: a risk to human health,� The Lancet Infectious Diseases; Oct. 2005; vol. 5, p.637-646

Agnet Sept. 30/05

Genetically engineered plants called no threat to human health

Calcium-enhanced potatoes offer a new healthy choice

Arming ryegrass for the fight against crown rust

Croplife International launches guidance document for field trials of biotech crops

Persistence of seeds from crops of conventional and herbicide tolerant

Markedly different gene expression in wheat grown with organic or inorganic fertilizer

Experts maintain 'co-existence' of GM and GM-free crops biologically impossible

Effects of genetically modified herbicide-tolerant cropping systems on weed seedbanks in two years of following crops

Tomato yellow vein streak virus - Brazil

New program prompts technological innovation

Return of the native: ARS scientists stimulate growth of native Aspen trees

PMF proceedings for the March 2005 workshop have been posted on the PBO web site

With gas prices this high, try vegetable oil

Calcium-enhanced potatoes offer a new healthy choice
September 30, 2005
Checkbiotech
Katharina Schoebi
The majority of people do not consume enough calcium and are thus suffering from health problems. Transgenic potato tubers containing up to three-fold more calcium may soon be an edible tool for boosting calcium consumption.
The body needs calcium to reduce osteoporosis, a disease characterised by reduced bone density and the primary cause of bone fragility. The recommended amount of daily calcium intake depends on the person�s age. For example, nursing children need between 220 to 400 milligram of calcium per day. The older a child becomes, the more calcium it needs. A teenager should consumer around 1.2 gram calcium per day, whereas adults should eat 1.5 gram of calcium per day.
Dairy products are a good source of calcium. Cheese is especially rich in calcium. A 100 gram piece of Parmesan contains 1,180 milligram of calcium. Thus, the daily calcium need would already be met by eating a piece of cheese and drinking a glass of milk.
However, some individuals suffer from lactose intolerance and thus limit their consumption of dairy products or even avoid it totally, while some ethnic groups do not use dairy products in their diet, or restrict them considerably. These individuals have to meet their daily calcium needs by eating vegetables and fruit. Unfortunately, widely consumed vegetables, such as potatoes, grains and rice, do not contain enough calcium. For example, an average tuber of boiled potato contains only 20 milligram of calcium. Given that an average person would eat one boiled potato per day, one would consume 7.3 gram calcium in a year � the amount recommended for only one week!
�If we double or triple the amount of calcium in a tuber, we could provide several weeks worth of the dietary reference intakes of calcium,� said Dr. Kendal Hirschi from the Baylor College of Medicine in Houston, Texas, in his publication in the Journal of Agricultural and Food Chemistry.
The reason for Dr. Hirschi�s excitement was that his publication dealt with transferring a gene that encodes the calcium transporter CAX1 to a potato variety. CAX1 is a calcium transporter in the vacuole membrane of plants. The researcher�s hypothesis was that increased activity of CAX1 in potatoes should result in an increase in total calcium level. This hypothesis was based on his past research that CAX1 increased calcium levels in tobacco (Plant Cell, 1999).
Analyzing their data, the researchers found out that the transgenic potato tubers contained 1.5- to 3-fold more calcium than natural tubers, and in transgenic leaves, the calcium levels increased up to 1.7-fold. Since even the third generation of potato plants showed an increase in calcium content, the researchers believe that this trait is stable through successive generations.
Overall, comparing the mineral content and consistency of common potato varieties and calcium-enhanced potatoes, Dr. Hirschi�s group was not able to find any differences.
The researchers underline, however, that no single food source will rectify calcium intake deficiencies alone and the genetically enhanced potatoes follows suite. Thus, transgenic potatoes will not cure osteoporosis, but they rather will provide additional calcium and will be a model for the modification of the calcium content in many more food crops, Dr. Hirschi and his colleagues argue.
To assess the so called bioavailability of calcium (the amount of calcium that can be digested, absorbed and used by the body) further studies are needed. Right now, the researchers are undertaking feeding studies in mice to see if the transgenic potatoes are actually more nutritious. In addition, some experiments should assess if calcium-enhanced potatoes still taste like common commercial varieties.
Since there is some evidence that genetic transformation does not alter either the ethylene levels or the sugar content of tomatoes, Dr. Hirschi suggests that transgenic potatoes will also taste like common varieties.
The research group has carried out some experiments to determine, whether a higher calcium amount in the tuber affects the vitamin C content of the potatoes. With greenhouse grown potatoes, they did not see any difference. In addition, the consistency appears to be similar, but at this point the researchers have not finished their work in this area. Dr. Hirschi told Checkbiotech.
Future studies will also be done to find out if increasing calcium levels will decrease the incidence of pathogen infection and post harvest decay, two major problems worldwide. �Our hope is that the modifications will lower the incidence of postharvest infection and will not alter the insect attacks on the plants,� Dr. Hirschi explained.
Plants need calcium for normal growth and development, and it is especially critical for correct cell wall and cell membrane formation. It is known that potatoes grown in calcium enriched soils have an increased tuber quality, whereas calcium deficiencies in potatoes result in internal disorders such as: hollow-heart, internal brown spot, brown center and reduced storage life. Thus, transgenic potatoes containing higher calcium levels could lead to better yields for farmers and a more nutritious product for consumers.
Dr. Hirsci looks forward to working with the Vegetable and Fruit Improvement Center at Texas A&M. This center specializes in working with growers to bring new produce options to consumers.
Dr. Hirschi and his team have recently carried out similar studies with tomatoes and carrots, and he noted, �We should try as many plants as possible.� The results of his study are encouraging, Dr. Hirschi said. However, a lot more work needs to be done to show these plants are durable and safe. �Working with plants is fun, because you can try to help people � but it is a slow process.�
Katharina Schoebi is a biologist and Chief Science Writer for Checkbiotech. Contact her at katharina.schoebi@....
Kendal D. Hirschi et al. Genetic Manipulation for Enhancing Calcium Content in Potato Tuber. Journal of Agricultural and Food Chemistry. (2005) 53, pp. 5598-5603
Link to the abstract: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=15998121&dopt=Citation
Kendal D. Hirschi et al. Expression of Arabidopsis CAX1 in Tobacco: Altered Calcium Homeostasis and Increased Stress Sensitivity. Plant Cell. (1999) 11, pp. 2113-2122

Arming ryegrass for the fight against crown rust
September 30, 2005
Checkbiotech
Katharina Schoebi
Crown rust (Puccinia coronata) is the most serious foliar fungal disease in ryegrass species. A new genetically engineered Italian ryegrass (Lolium multiflorum Lam.) produces an enzyme that destroys the fungus and thereby increases resistance against crown rust disease.
Italian ryegrass is one of the most important forage grasses in temperate regions. The infection of the grass with the fungal pathogen crown rust results in decreased yields and lower grades of animals feed. That is why ryegrass breeding programs try to develop plant varieties that show high resistance to crown rust.
Conventional breeding of Italian ryegrass by selection proceeds very slowly, because the plant is self-infertile and thus, each cultivar has a diverse genetic background. Genetic engineering, in contrast, can be a promising tool for efficient breeding of ryegrass plantlets that are resistant to the fungus crown rust.
When plants are infected by a fungal pathogen, some of them produce an enzyme called chitinase. Chitinase hydrolyzes a structural component of the fungal cell wall, called chitin. When chitin is broken apart, the cell wall of the fungus � and thus the fungus, too - are destroyed. Furthermore, the small degradation products of chitin elicit the defense system of the plant. However, most of plant species do not contain a chitinase gene and are thus at the mercy of fungal pathogens.
By introducing the chitinase gene into tobacco, canola, strawberry, cucumber, rice, wheat, grape and cotton plants, their resistance to a wide range of fungal pathogens can be enhanced. �Thus, we hoped that the chitinase gene would also confer resistance to crown rust on Italian ryegrass as well,� explained Dr. Takahashi of the Forage Crop Research Institute in Higashiakada, Japan.
For this purpose, the researchers introduced the rice chitinase gene in Italian ryegrass varieties, which gave them the ability to produce the chitin-destroying enzyme. The evaluation of the experiment indicated that the transgenic plants exhibited higher chitinase activity than untransformed ryegrass plants.
However, detached leaves of both untransformed and transgenic leaves showed disease symptoms which gradually progressed. And even though detached leaves of the genetically modified plants showed a somewhat increased resistance to crown rust disease, after more than ten days following infection, the transgenic and nontransgenic ryegrass plants were indistinguishable. Thus, resistance to crown rust disease with Dr. Takahashi�s Italian ryegrass is only partial for now. Though chitinase prevented fungal growth, it does not completely hinder the invasion of an attacking pathogen into the host plant cell.
In the meantime, however, Dr. Takahashi and his colleagues have found some true resistance genes for crown rust disease. The researchers are now attempting to isolate these genes. �We expect that, in the future, we will be able to completely protect the ryegrass by introducing the true resistance genes in it,� Dr. Takahashi told Checkbiotech.
According to the researchers, the resistance against crown rust shown by transgenic ryegrass would not be strong enough to carry out greenhouse and field trials. �We will do such experiments not before having produced genetically engineered plants that show stronger resistance to the fungal pathogen,� emphasized Dr. Takahashi.
However, before these experiments can be realized, some practical ideas for the prevention of gene flow have to be established, because �Italian ryegrass is an outcrossing plant that is pollinated by the wind,� Dr. Takahashi explained. And there are many naturally growing ryegrass plants that could cross with the transgenic ryegrass plants.
�We are now evaluating the disease resistance of the male sterile offspring of the plants we have genetically engineered,� continued Dr. Takahashi. Male sterility is advantageous, as it prevents gene flow from transgenic plants to the environment.
When asked if the overproduction of chitinase by genetically engineered plants would have an effect on herbivores, such as grass-eating domestic animals, Dr. Takahashi told Checkbiotech, �I think this possibility is very low because chitinase commonly exists in plants.� However, a possible allergic reaction in a small number of individuals could not be ruled out. �Indeed, in humans, products of some plant defence-related genes are known to be suspicious allergens.�
A further aspect that has to be considered is how to prevent other (beneficial) fungi, for example fungi that the plants need for nutrient uptake, from the effects of chitinase in transgenic plants. Dr. Takahashi supposes that this could be achieved by controlling the chitinase production. By inducing special signal sequences in the plant genome, the enzyme could be produced only at rust infection sites, he explained.
Dr. Takahashi�s work will bring the research community one step closer to understanding how to produce crops that are resistant to fungal pathogens. He is now engaged both in the development of molecular markers that are linked to resistance genes for the ryegrass blast and in the production of blast-resistant ryegrass varieties.
Katharina Schoebi is a biologist and Chief Science Writer for Checkbiotech.
Tadashi Takamizo et al. Increased resistance to crown rust disease in transgenic Italian ryegrass (Lolium multiflorum Lam.) expressing the rice chitinase gene. Plant Cell Rep (2005) 23:811�818 (DOI 10.1007/s00299-004-0900-1)
Link to the abstract: http://www.ncbi.nlm.nih.gov/entrez/query.fcgi?cmd=Retrieve&db=PubMed&list_uids=15599752&dopt=Citation

Croplife International launches guidance document for field trials of biotech crops
September 30, 2005
Crop Life International
BRUSSELS - CropLife International announces the release of its new general compliance management document for conducting confined field trials of biotech crops. Confined field trials refer to small-scale experimental field trials of a genetically engineered plant species performed under the terms and conditions that mitigate impacts on the surrounding environment.
This practical tool demonstrates industry's commitment to proper stewardship of biotechnology products by ensuring that confined field trials are conducted under appropriately controlled conditions and in a workable and efficient manner. lt also assists countries by providing a model around which national guidelines can be developed. This is particularly important for developing countries, where regulations may not currently exist.
Biotech stewardship refers to the ethical management of a biotechnology product from its discovery or development, through to its ultimate use and discontinuation. The plant science industry is committed to promoting full and effective stewardship to the field level, and believes that the appropriate management and use of its products is an important element underpinning sustainable agriculture and safeguarding the environment and public health.
"We are committed to help build and strengthen research and regulatory capacities, especially in developing countries, so that biotechnology's benefits can be maximised, and any risks minimised," stated Christian Verschueren, Director General of CropLife International. "This new document is a very practical tool that is relevant for researchers, policymakers and industry. lt provides general information, as weIl as technical guidance, which will heip countries ensure safe and proper field research into biotechnology products."
The document presents an overview of the current status of field trials in developing countries, and highlights case studies from several countries that have successfully transitioned from field-testing to commercial approvals (Argentina, India, the Philippines and South Africa). lt also provides useful information that may be used to ensure quality at each stage of a field trial, including:
Transportation and storage of experimental biotech plant material
Management of the confined trial site, including reproductive isolation of experimental species and corrective actions to take in the case of accidental release
Harvest and disposition of materials
Management of the trial site after harvest
In addition, sample standard operating procedures and regulatory templates are provided, which can be easily adapted to suit local needs and conditions. Training workshops using this guidance document are taking place around the world, targeting government officials and representatives from public and private sector research groups. The first took place in New Delhi , India on 9 August 2005 to coincide with a government review of its field trial guidelines, and was attended by 115 participants. The next workshop is scheduled to take place in the Philippines . More information and electronic copies of the guidance document can be found at www.croplife.org/biotechstewardship.

Persistence of seeds from crops of conventional and herbicide tolerant
September 30, 2005
Biological Sciences
Peter J.W. Lutman A1, Kate Berry A1, Roger W. Payne A1, Euan Simpson A2, Jeremy B. Sweet A2, Gillian T. Champion A3, Mike J. May
A1 Rothamsted Research Harpenden Herts AL5 2JQ, UK A2 NIAB Huntingdon Road, Cambridge CB3 0LE, UK A3 Broom�s Barn Research Station Higham, Bury St Edmunds, Suffolk, IP28 6NP, UK A4 The Scottish Agricultural College Kings Buildings, West Mains Road, Edinburgh EH9 3JG, UK A5 The Arable Group Morley St Botolph, Wymondham, Norfolk NR18 9DB, UK Abstract: A series of rotation experiments at five sites over four years has explored the environmental and agronomic implications of growing herbicide tolerant oilseed rape and sugar beet. This paper reports on the population dynamics of volunteer rape (Brassica napus). The experiments compared four winter oilseed rape (WOSR) cultivars: a conventional cultivar (Apex) and three developmental cultivars either genetically modified (GM) to be tolerant to glyphosate or glufosinate, or conventionally bred to be tolerant to herbicides of the imidazolinone group. Seed losses at harvest averaged 3575 seedsm-2 but ranged from less than 2000 up to more than 10000 seedsm-2. There was a rapid decline in seed numbers during the first few months after harvest, resulting in a mean loss of seeds of 60%. In subsequent seasons, the seedbank declined much more slowly at four of the five sites (ca 20% per year) and the models predicted 95% seed loss after approximately 9 years. Seed decline was much faster at the fifth site. There were no clear differences between the four cultivars in either the numbers of seeds shed at harvest or in their subsequent persistence. The importance of the persistence of GM rape seeds, in the context of the coexistence of GM and non-GM crops and the role of good management practices that minimize seed persistence, are discussed.

Markedly different gene expression in wheat grown with organic or inorganic fertilizer
September 30, 2005
Biological Sciences
Chungui Lu A1 A2, Malcolm J. Hawkesford A1, Peter B. Barraclough A1, Paul R. Poulton A1, Ian D. Wilson A2, Gary L. Barker A2, Ke
A1 Rothamsted Research Harpenden AL5 2JQ, UK A2 University of Bristol School of Biological Sciences Bristol BS8 1UG, UK Abstract: Nitrogen is the major determinant of crop yield and quality and the precise management of nitrogen fertilizer is an important issue for farmers and environmentalists. Despite this, little is known at the level of gene expression about the response of field crops to different amounts and forms of nitrogen fertilizer. Here we use expressed sequence tag (EST)-based wheat microarrays in combination with the oldest continuously running agricultural experiment in the world to show that gene expression is significantly influenced by the amount and form of nitrogenous fertilizer. In the Broadbalk winter wheat experiment at Rothamsted in the United Kingdom and at three other diverse test sites, we show that specific genes have surprisingly different expression levels in the grain endosperm when nitrogen is supplied either in an organic or an inorganic form. Many of the genes showing differential expression are known to participate in nitrogen metabolism and storage protein synthesis. However, others are of unknown function and therefore represent new leads for future investigation. Our observations show that specific gene expression is diagnostic for use of organic sources of nitrogen fertilizer and may therefore have useful applications in defining the differences between organically and conventionally grown wheat.

Experts maintain 'co-existence' of GM and GM-free crops biologically impossible
September 30, 2005
Consumers International
Leading experts maintained that it is biologically impossible for GM and GM-free crops to co-exist, at a conference organised by Consumers International (CI) and Regione Emilia-Romagna. Ignacio Chapela, Associate Professor at University of California-Berkeley, told CI: '"Co-existence" might be a convenient thing to have politically or commercially but biologically it is an impossibility. For most GMOs the problem of contamination arises immediately: within one generation you have escaping genes.'
Ignacio Chapela was one of fourteen experts speaking at a conference '"Co-existence", contamination, and GM-free zones: Jeopardising consumer choice?' in Bologna, Italy on 9 September 2005. Speeches mostly tackled problems with GM contamination and how to legally and technically maintain GM-free agriculture.
Angelika Hilbeck, ETH - Swiss Federal Institute of Technology Zurich, told the conference: '[trying to prevent GMO contamination] starts with the seeds; you want to make sure you get uncontaminated seeds. This is the origin of everything - from there on the contamination multiplies. For example, in Canada it is hardly possible to get GM-free canola seeds any more. Even the seed stock has been contaminated at this point.'
Benedikt Haerlin, Director of Save our Seeds and Foundation on Future Farming, told CI: '[the term] "co-existence" as used by industry means that those rejecting GMOs have to accept a so-called minimum level of GM contamination.'
David Cuming, GM Campaigns Manager, Consumers International says:
'Listening to the experts it is apparent that contamination will occur if GM crops are planted alongside GM-free crops. Governments must take urgent measures to stop GMO contamination to ensure that GM-free food remains widely available to all consumers.'
Read speeches, exclusive interviews, and other resources about GMO contamination, 'co-existence' and GM-free zones:
http://www.consumersinternational.org/Templates/Internal.asp?NodeID=93963&int
1stParentNodeID=89650&int2ndParentNodeID=89677
www.consumersinternational.org

Effects of genetically modified herbicide-tolerant cropping systems on weed seedbanks in two years of following crops
September 30, 2005
Biology Letters
L.G. Firbank A1, P. Rothery A2, M.J. May A3, S.J. Clark A4, R.J. Scott
A1 Lancaster Environment Centre Centre for Ecology and Hydrology Library Avenue, Bailrigg, Lancaster LA1 4AP, UK A2 Abbots Ripton Centre for Ecology and Hydrology Huntingdon, Cambridgeshire PE28 2LS, UK A3 Broom�s Barn Research Station Higham, Bury St Edmunds, Suffolk IP28 6NP, UK A4 Winfrith Technology Centre Centre for Ecology and Hydrology Dorchester, Dorset DT2 8ZD, UK A5 Rothamsted Research Harpenden, Hertfordshire AL5 2JQ, UK A6 Scottish Crop Research Institute Invergowrie, Dundee DD2 5DA, UK Abstract: The Farm Scale Evaluations (FSEs) showed that genetically modified herbicide-tolerant (GMHT) cropping systems could influence farmland biodiversity because of their effects on weed biomass and seed production. Recently published results for winter oilseed rape showed that a switch to GMHT crops significantly affected weed seedbanks for at least 2 years after the crops were sown, potentially causing longer-term effects on other taxa. Here, we seek evidence for similar medium-term effects on weed seedbanks following spring-sown GMHT crops, using newly available data from the FSEs. Weed seedbanks following GMHT maize were significantly higher than following conventional varieties for both the first and second years, while by contrast, seedbanks following GMHT spring oilseed rape were significantly lower over this period. Seedbanks following GMHT beet were smaller than following conventional crops in the first year after the crops had been sown, but this difference was much reduced by the second year for reasons that are not clear. These new data provide important empirical evidence for longer-term effects of GMHT cropping on farmland biodiversity.

Tomato yellow vein streak virus - Brazil
September 30, 2005
A ProMED-mail post
A ProMED-mail post
http://www.promedmail.org
ProMED-mail is a program of the International Society for Infectious Diseases http://www.isid.org Sponsored in part by Elsevier, publisher of Tropical Infectious Diseases, 2nd Edition http://thelancet.url123.com/a5445
Date: 29 Sep 2005 From: ProMED-mail promed@... British Society for Plant Pathology, New Disease Reports, Vol. 12 [edited] http://www.bspp.org.uk/ndr/jan2006/2005-70.asp
Potato deforming mosaic disease is caused by an isolate of Tomato yellow vein streak virus
S.G. Ribeiro simone@... , Embrapa Recursos Geneticos e Biotecnologia, Pq. Estacao Biologica, Brasilia, DF, Brazil; A.K. Inoue-Nagata, Embrapa Hortalicas, C. Postal: 0218, 70359-970, Brasilia, DF, Brazil; J. Daniels, Embrapa Clima Temperado, Rodovia BR 392, km 78, Pelotas, RS, Brazil; and A.C. de Avila (Inoue-Nagata) Accepted for publication 8 Sep 2005.
The disease known as potato deforming mosaic was first reported in the 1980�s in Southern Brazil (Daniels Castro, 1985). Symptoms of mosaic with leaf distortion were seen in infected potato plants and a virus was suggested as the causal pathogen. In this study, we have characterised the causal agent of this disease by transmission experiments and molecular analysis of the viral genome.
The original virus isolate was collected from a potato plant in 1983 in the State of Rio Grande do Sul and maintained through vegetative propagation in the greenhouse. The virus was easily transmitted from potato by the whitefly Bemisia tabaci biotype B causing mottling, chlorotic spots and leaf distortion on tomato, vein-banding and mosaic on Nicotiana benthamiana and vein-clearing on Nicandra physaloides . These properties are consistent with the disease agent being a geminivirus.
PCR amplification using primers CP2 (5�cccctgcagaacttccaagtctggacg3�) and PAL1v1978 (Rojas et al., 1993) produced a DNA A derived fragment of 1.8 Kb encoding the entire coat protein gene, common region and part of the AC1 gene. Sequence comparison showed highest identity (97.3 percent) to Tomato yellow vein streak virus (ToYVSV-U79998), a virus previously described in tomatoes in Brazil (Faria et al., 1997). The presence of a B component was confirmed by PCR with primers B1200F 5�CCCCTGCAGTAYTAYTGYTGGATGTC3�) and B1900R (5�cccctgcagrtgyaacatwgatctcc3�); with amplification of a fragment of approximately 800nt comprising the 3� end of the BV1 gene, the small intergenic region and the 5� half of the BC1 gene.
Our results indicate that the potato deforming mosaic and tomato yellow vein streak diseases are caused by the same geminivirus, belonging to the genus Begomovirus . Potato deforming mosaic disease was described more than 20 years ago but was of little economical relevance (Daniels Castro, 1985). Since then this virus, now named Tomato yellow vein streak virus (ToYVSV), has re-emerged and is currently the major begomovirus affecting tomatoes and potatoes in the state of Sao Paulo (Souza-Dias et al., 2003).
This is the 1st record of natural infection of ToYVSV in potato.
Acknowledgement
We wish to thank Dr Marcel Prins for his comments.
References
Daniels, J, Castro LAS, 1985. Ocorrencia do virus do mosaico deformante da batata no Rio Grande do Sul. Fitopatologia Brasileira 10, 306.
Faria JC, Souza-Dias JAC, Slack S, Maxwell DP, 1997. A new geminivirus associated with tomato in the State of Sao Paulo, Brazil. Plant Disease 81, 423.
Rojas MR, Gilbertson RL, Russell DR, Maxwell DP, 1993. Use of degenerate primers in the polymerase chain reaction to detect whitefly-transmitted geminiviruses. Plant Disease 77, 340-347.
Souza-Dias JAC, Sawasaki HE, Santini A, 2003. Plantio sucessivo de batata e tomate na regiao de Sumare, SP favorece a presenca do Tomato yellow vein streak geminivirus (ToYVSV) e da mosca branca vetora. Fitopatologia Brasileira 28, 372.
[It is interesting that it took over 20 years to recognize that ToYVSV and Potato yellow deforming virus were one and the same virus. In potato, the apical leaves showed yellow or green mottle which developed into leaf distortion with yellow blotches (apparently no natural infection have been found on potato). About 20 percent of young tomato plants showed virus symptoms. Tomato is an important crop in the EPPO region, and both indoor and outdoor and the virus vector is present in many parts of the EPPO region. The disease appears so far, limited in Brazil but data is lacking about its extent and severity. It is not known whether potato can be naturally infected
Links: http://gemini.biosci.arizona.edu/viruses/toyvsv/ http://www.scielo.br/scielo.php?pid=S0100-41582003000200007&script=sci_abstra ct&tlng=en

New program prompts technological innovation
September 28, 2005
SPARKPlug
Sarah Fischer and Mitch Ritter
A unique award that supports technological research has led to the creation of an innovative company dedicated to the development of leading edge technologies for the greenhouse industry.
University of Guelph Ph.D. candidate Jamie Doran, Department of Plant Agriculture was recently awarded the Martin Walmsley Fellowship for Technological Entrepreneurship. The prestigious award � valued at $100,000 � will enable Doran and his colleague Jeff Huber, a M.Sc. candidate in the Department of Environmental Biology, to focus their entrepreneurial efforts on their new company, Glass Onion. The company will target technologies for the allium industry, which includes garlic, leeks and onions.
�Glass Onion is a broad based company that will touch many different areas of the allium industry - from spices to nutraceuticals, from field production to a new greenhouse industry,� says Doran.
The Martin Walmsley Fellowship for Technological Entrepreneurship, typically awarded to the medical and computer related sciences, is awarded by the Ontario Centres of Excellence (OCE) to foster entrepreneurial spirit and facilitate the transfer of technology. It�s awarded to a researcher associated with the development of intellectual property worthy of commercialization, who plans to establish a new technologically innovative business venture based on OCE intellectual property.
Doran is the only recipient from Ontario this year. He and Huber plan to use the fellowship as a stepping stone to get their business off the ground. Glass Onion is a result of their combined expertise.
�Developing this business allows us to mesh our academic research with practical application,� says Doran. �We want the industry to benefit from our research, and Glass Onion will help make sure the applications get to market.�
Glass Onion is working to develop technologies such as a pungency assessment tool, clean seed garlic and a protocol to produce concentrated flavour extracts. These technologies will benefit cultivation, processing and the marketing of allium products across the industry. Growers, brokers, distributors, retailers, spice and extraction producers, and food processors will be the target markets.
Glass Onion has its sights on developing a virus-free garlic seed. Currently, the majority of the Canadian garlic is imported, due to higher foreign production volume and a lower cost per pound. Local production is limited further by the hardships of viruses and fungi, which reduce quality and yield. Furthermore, alliums have been identified as candidate species for incorporation into space food production systems, but more information is needed about gas exchange rates and environmental response under closed environment conditions (CES).
Virus-free seed (cloves) has been shown to increase yields up to 50 per cent. Doran and Huber are planning to set up facilities to produce virus-free garlic seed stock through tissue culture techniques. A component of this process will require growing garlic in the greenhouse and the development of the associated technologies.
�People are amazed to find out that up to 95 per cent of the garlic consumed in Canada comes from imported sources,� says Doran. �But Glass Onion is set up to help local growers improve the quality and quantity of their garlic and secure a greater market share.�
Current production of allium extracts, such as garlic powder and liquid extract, results in losses of up to 80 per cent of the active ingredients. To compensate, extract manufacturers must use large amounts of produce to develop a quality product. Glass Onion is developing alternative methods to produce highly concentrated extracts that require less produce for the same end result, boosting producers� profit.
Glass Onion will work with Bioenterprise, a non-profit company that assists scientists in the commercialization of their ideas.
Doran�s research is sponsored by the Ontario Fruit and Vegetable Growers Association, Earth and Environmental Technologies (ETech, formerly CRESTech), and the Ontario Ministry of Agriculture and Food. Doran is advised by Profs. Bernie Grodzinski and Mary Ruth McDonald. Huber�s research is sponsored by private industry and is advised by Profs. Michael Dixon and Youbin Zheng.

Return of the native: ARS scientists stimulate growth of native Aspen trees
September 30, 2005
ARS News Service
Agricultural Research Service, USDA
http://www.ars.usda.gov/is/pr
Methods to restore aspen woodlands being overrun by conifers are being studied by Agricultural Research Service (ARS) scientists and cooperators in Oregon.
With its fiery fall foliage, quaking aspen has thrilled generations of leaf watchers. But it�s more than just a pretty face: This delightful deciduous tree is an influential member of its environmental community. Unfortunately, aspens are rapidly losing ground to coniferous woodlands in an arboreal turf war.
Like the mythical phoenix, aspens rely on fire to promote regeneration. New shoots arise from parent root systems in response to disturbances. But as fire suppression has increased, other species have begun to invade the aspen territory, according to rangeland scientist Jon Bates at the ARS Range and Meadows Forage Management Research Unit in Burns, OR. He is cooperating with the Bureau of Land Management and private landowners to investigate the effects of cutting and burning invading conifers on aspen regeneration.
Bates wanted to compare the effects of burning in autumn versus burning in spring. Within selected aspen groves, he cut a third of the invading juniper trees, then set them ablaze. Burning in autumn, he discovered, stimulated the aspen and removed all remaining juniper. It also removed almost all ground cover, initially. Spring burning partially stimulated the aspen, and only removed 90 percent of the mature junipers and 50 percent of the seedlings, while promoting rapid recovery of the understory�the species growing under the trees.
Aspen groves support many wildlife species. They have more diverse and productive understories than conifers, providing more forage for livestock. In addition, they generally release more water into the watershed, aiding anglers and agronomists alike. Bates� research proves that spring and autumn burning successfully promote aspen growth, with different effects on surrounding vegetation. Public land managers and private land owners can choose either option, depending on their objectives.
ARS is the U.S. Department of Agriculture�s chief scientific research agency.

PMF proceedings for the March 2005 workshop have been posted on the PBO web site
September 30, 2005
Canadian Food Inspection Agency
PMF proceedings for the March 2005 workshop have been posted on the PBO web site
The link to the proceedings report is :
http://www.inspection.gc.ca/english/plaveg/bio/mf/fracad/techenviroe.shtml
The link to the consultation's web page is :
http://www.inspection.gc.ca/english/plaveg/bio/mf/fracad/fracade.shtml

With gas prices this high, try vegetable oil
September 30, 2005
The Globe and Mail
Barrie McKenna with files from Reuters
http://www.theglobeandmail.com/servlet/ArticleNews/TPStory/LAC/20050930/FUEL30/International/Idx
WASHINGTON�Today's sky-high oil prices have, according to this story, sparked renewed interest in a cornucopia of exotic vehicle fuel substitutes.
Consumers in energy-hungry China are turning to molasses and cassava root to fuel their cars. Many French are trying to beat the high cost of diesel by illegally pouring sunflower oil into their tanks. And the Germans are clearing grocery store shelves of rapeseed, or canola oil, to fill up on the cheap.
Brazilians are already the world's biggest consumers and producers of ethanol for their cars. Forty per cent of all the fuel that Brazilians put in their vehicles is now ethanol, made from abundant and cheap sugar cane.
Ted Breton, director of energy market forecasting at Pace Global Energy Services in Fairfax, Va., was quoted as saying, "I don't think we have a lot of options, except driving less. We aren't about to switch to rapeseed oil because our diesel isn't that much more expensive, and because most people don't drive diesel cars."
Besides, if everyone started putting vegetable oil into the cars, the price would likely climb because there wouldn't be enough production to supplant diesel, Mr. Breton said.
The story says that the conditions that make these exotic substitutes attractive in other countries simply aren't yet present in Canada and the United States.
The French are tempted by sunflower oil not because it's that much cheaper than diesel, but because it's not subject to Europe's very high fuel taxes. And there are a lot more diesel cars on the road there, again because of tax anomalies.
Brazil has made bio-fuel work because it has a large fleet of passenger vehicles that can run on as much as 100-per-cent ethanol. And unlike North America, the ethanol market survives without subsidies thanks to plentiful and fast-growing sugar cane, combined with a government mandate requiring that gasoline contain at least a quarter alcohol. The result is that ethanol sells for less than gasoline in Brazil, the reverse of typical market conditions in North America.
The story notes that in Canada and the United States, ethanol is heavily subsidized to enable it to compete with gasoline. And even then, it not used as a substitute for gasoline, but as an oxygenating agent to create cleaner emissions and boost air quality.
Conventional North American cars can take a gasoline blended with up to 10 per cent ethanol. But they become significantly less fuel efficient the more ethanol you put in the gas.
Putting more ethanol into the gasoline supply would require aggressive, Brazilian-style mandates, heavy investment in special tanks and pumps and an overhaul of the vehicle fleet.
But ethanol fans insist the investment is worth it. A recent study by the American Coalition for Ethanol found that blends with up to 30-per-cent ethanol offer slightly poorer fuel economy than straight unleaded gasoline but winds up being cheaper to run when ethanol is cheaper than gas.
Brian Jennings, executive vice-president of the American Coalition for Ethanol, was quoted as saying, "Using ethanol is like money in your pocket, and you feel good about filling up on this homegrown fuel because it comes from America's farm fields, not the oil fields of the Middle East."
Bob Dinneen, president of the Renewable Fuels Association, was cited as saying that new energy legislation passed in the U.S. Congress has mandated that at least 5 per cent of the U.S. gasoline supply should come from ethanol and other bio-fuels by 2012. Public policy makers are catching up," said.
But don't expect ethanol to significantly reduce U.S. dependence on foreign oil any time soon. Aaron Brady, associate director of oil research at Cambridge Energy Research Associates, was cited as saying that even after a massive expansion of the ethanol industry, it still makes up less than 3 per cent of the nine million barrels of gasoline that Americans consume daily.

#4149

From: Doug Powell <dpowell@...>
Date: Sat Oct 1, 2005 2:37 am
Subject: Agnet Sept. 30/05 -- II

dpowell@...

how to subscribe

Genetics may have saved corn crops
September 30, 2005
Medill News Service
Alexander V. Ragir
Industry participants were cited as saying Thursday that the U.S. corn harvest after this summer's drought may turn 2005 into a hallmark year in the genetic modification of plants.
The story says that if government predictions are correct, corn production this year will be the second-highest in U.S. history, despite the droughts in major corn-producing states, such as Indiana and Illinois, and corn experts give much credit to the widespread use of corn that has been genetically modified to protect from bugs, making them more resilient to adverse weather conditions.
Tim Hannagan, senior grain analyst at Alaron Trading Corp, a Chicago-based futures trading firm, was quoted as saying, "This year is the fourth-driest summer in 100 years with over 60 percent of the U.S. grain belt in a drought, yet we're seeing yields that are far greater than before. � Ten years ago without genetically altered corn, (the drought) may have cut production by two to two and a half billion bushels," and that this year, the decline is about 1.2 billion bushels, he said.
The last time it was this hot was the summer of 1995. That drought, although more severe, stifled production. The corn price doubled that year, reaching a high of $5.50 a bushel. But now, corn futures expiring in December closed at the Chicago Board of Trade on Thursday at $2.034 a bushel.
Gerry Gidel, a crop analyst at Midland Research Inc. in Chicago was cited as saying that corn is now a completely different product, adding, "Weather now has just a modest impact on the harvest."
In 2005, one in three bushels of Illinois corn was genetically modified.
More than half of the nation's corn is genetically modified.
Rodney Weinzierl, executive director of the Illinois Corn Growers Association, was cited as saying that traditional breeding methods used to improve corn seed are still more effective than creating genetically modified seeds, but the two taken together have changed the farmer's life, adding, "Weather is becoming less
Important. But it still is the most important."
For fifth-generation farmer Leon Corzine, genetically modified crops have changed his life in more ways than just how intently he listens to the weatherman. Harvests on his soybean and corn farm in Assumption, Ill., have grown by 30 percent in the seven years he has been using the technology.

Agnet Sept. 30/05 -- II

Genetics may have saved corn crops

Homespun Bt here at last

GMO ban and junk science

The UN�s biotech for food scandal

China seeks boost from biofuels

Irwin Schmidt receives CropLife Canada's chairman's award recognized for lifelong innovation in agri science industry

Mexican fruit fly; quarantined areas and treatments for regulated articles

West Indian fruit fly; regulated articles

Citrus from Peru

Homespun Bt here at last
September 30, 2005
The Indian Express
Vivek Deshpande
http://www.indianexpress.com/
NAGPUR - After facing criticism for years of failure in developing its own Bt cotton, the Central Institute for Cotton Research (CICR) now has, according to this story, been able to introduce the Cry1 Ac gene in an Indian cotton variety and, if all goes well, the institute�s Bt will hit the market in another two years.
Director B M Khadi was cited as saying he is confident the breed will be a success, adding, "The CICR Bt will be an independent variety, which the farmers won�t have to buy every year from the market like the Bt hybrids available currently. Moreover, it will be much, much cheaper than those now available."
CICR has been trying to develop India�s own Bt since the early 1990s.

GMO ban and junk science
September 30, 2005
Sonoma Index Tribune Via AgBioView at www.agbioworld.org
Bill Lynch
http://www.sonomanews.com/articles/2005/09/28/news/editorial_and_letters/letter01.txt
We know that they're generally on the opposite ends of the political spectrum, but the advocates for banning genetically modified crops, seeds, etc., seem to have a lot in common with the promoters of teaching creationism as a science. They both attempt to blur the lines between belief and scientific research in order to promote a strongly held point of view.
Applied study at major research universities by very smart, well-educated, well-trained, experienced scientists has high value in our society. Americans respect the hard-earned credentials of top-level scientists. They trust, use and benefit from the contributions researchers have made to the quality of their lives.
For the majority, religious beliefs do not conflict with science to the point of holding back progress toward cures for disease, new surgical techniques to save lives, or agricultural advances to grow more crops to feed the hungry.
Now, at the beginning of the 21st century, we see New Age philosophies and old-fashioned evangelical religion seeking to gain equal status with scientific research, with the potential to hold back the advances that have extended life expectancy and raised our standard of living.
Fortunately, the creationists haven't yet forced their beliefs into local science classrooms. Unfortunately, that is not true of those who want to ban "transgenic" (genetically engineered) crops and other organisms. They have managed to get a GMO ban proposition on Sonoma County's November ballot by planting seeds of doubt and fear about the current process by which the government now tests and regulates transgenic organisms. Ban advocates claim that government regulations are nowhere near enough protection against what could happen. Their major concern is that the "organic" farmers will have their crops contaminated by runaway GMOs that escape the fields in which they are used. From this fear flow other predictions of dire consequences.
There are a lot of things wrong with the proposed county GMO ban, not the least of which is the cost of enforcement and the potential damage to the local economy.
The ordinance's advocates want to ban the application of modern science in Sonoma County agriculture for 10 years. A laundry list of fears and worst-case predictions, without solid data behind them, is not nearly enough to justify such radical action.
Neither side in this dispute is free from self-interest. The anti-GMO movement has strong backing from the organic food industry and its special lobbying groups, while most local farmers, major agricultural corporations and the general food industry all have an interest in using science to increase productivity and profits.
Yes, this is about money, and it is about what local farms and vineyards produce. When the vast majority of farmers in the county say this ban will harm their businesses, we need to pay attention.
For this vote, please don't check your brains at the door. Read more. Be skeptical of fear-mongering. Look at the credentials of advocates closely. Who has credibility? What does the preponderance of scientific research say? And don't forget that the local economy depends a great deal on viable agriculture.
We are not finished with our reading and study on this topic, but, so far, we see little difference between the anti-scientific GMO ban, and other faith-based, flat-earth movements of the early 21st century.

The UN�s biotech for food scandal
September 30, 2005
Tech Central Station Via AgBioView at www.agbioworld.org
Henry Miller
CHIBA, Japan -- John Bolton, the blunt and controversial U.S. ambassador to the UN, has promised "to advance American interests and ideals at the United Nations." During his first two months on the job, Bolton has denounced the United Nations Development Program for its "unacceptable" funding of Palestinian propaganda and publicly identified "countries who are in a state of denial" about the need for UN reform. He told a reporter that he feels "a little like Rod Serling has suddenly appeared and we're writing episodes from 'The Twilight Zone.'"
I'm having a similar experience in Japan as a member of the US delegation to a UN task force on biotechnology-derived foods. The group is a creature of the Codex Alimentarius Commission, which sets food standards on behalf of the UN's Food and Agriculture Organization (FAO) and World Health Organization (WHO).
The very scope of this exercise -- which has gone on for five years and shows no signs of abating -- makes no sense. It is concerned with regulatory requirements only for foods made with the newest, most precise and predictable techniques of biotechnology -- while exempting others made with far more crude and less predictable technologies, including irradiation mutagenesis and hybridization.
For example, the task force has selected as one of its new projects, "Food Safety Assessment of Food Derived from [Gene-Spliced] Plants Modified for Nutritional and Health Benefits." This scope of work completely ignores that past problems with unexpected food toxicity in new plant varieties -- in two varieties each of squash and potato, and one of celery -- have resulted from the imprecision of conventional plant breeding. There is a broad scientific consensus that the precision of gene-splicing makes the accidental introduction of toxins or anti-nutrients into new foods far less likely. (Note that no food modified by traditional techniques -- that is to say, virtually the entire diet of Europeans and Americans -- could (or should) meet the existing Codex standards for biotech foods.) It is rather like circumscribing for extra regulation only automobiles outfitted with disk brakes, radial tires and air bags t-- and then limiting only those to a lower speed.
I've participated in these kinds of negotiations and meetings for more than a quarter-century, but never before have I had the same feeling that the inmates were running the asylum. This Codex travesty is rife with irony and hypocrisy.
First, the conference was opened by Japan's Vice-Minister for Health, Labor and Welfare, who extolled at length the virtues of biotechnology applied to agriculture and food production. However, his government has approved not a single food plant, fruit or vegetable for sale in Japan. In San Francisco, a gene-spliced, virus-resistant Hawaiian papaya costs about $1.25 per pound. Japan won't accept the gene-spliced variety, so they import only conventional Hawaiian papayas (mostly from trees that have been ratvaged by the papaya ringspot virus, which diminishes their yield)
and the cost in Tokyo is about $15 dollars a pound! (This vignette was less like "The Twilight Zone" and more like the British comedy, "Yes, Minister!")
Second, during the plenary the European Community's delegation sanctimoniously lectured the other nations on how to regulate biotechnology. Considering that biotech applied to agriculture is virtually nonexistent in Europe thanks to ill-conceived, unscientific over-regulation and intractable disagreements among European countries, this is rather like the government of Columbia instructing others on how to stop drug trafficking.
Third, at the same time that medical experts around the world are fearful of a pandemic of influenza that could kill tens of millions and disrupt the world's economy, the senior WHO representative kept lobbying the task force to work on "ethical considerations" of gene-spliced organisms. This bizarre concern about the "ethics" of a sweeter melon or pest-resistant potato is rather like worrying about flossing your teeth when you're in the path of a Category 5 hurricane.
Fourth, during five years of negotiations by this task force, the participants -- including the U.S. delegation, now headed by a senior USDA official -- have willfully ignored scientific principles and the basic axiom that the degree of regulatory scrutiny should be proportionate to risk. They have also disregarded the scientific consensus that gene-splicing is an extension, or refinement, of older, traditional techniques of genetic modification, and that it does not warrant discriminatory, excessive regultation. They have overlooked the fact that during almost two decades of widespread use, the performance of gene-spliced crops has been spectacular, with farmers enjoying increased yields, decreased costs of agricultural chemicals, and lower occupational exposures to pesticides. The environmental benefits likewise have been stunning, with less chemical runoff into waterways and greater availability of no-till farming techniques that reduce soil erosion.
Fifth, many who attended this meeting appear to be completely ignorant of the appropriate context of new and conventional biotechnology, unaware that with the exception of fish and wild game, berries and mushrooms, virtually all of the foods in our diet are derived from organisms that have been genetically improved in some fashion. It is pathetic -- and a cruel misuse of resources -- to see representatives here from countries like Sudan, Papua New Guinea, Uganda, Lesotho, Nepal and Laos clamoring for "capacity building" to regulate gene-splicing. Shouldn't the priorities of poor countries be nutritional deficiencies, infectious diseases, occupational safety, and the lack of childhood vaccines and clean water, rather than the discriminatory, gratuitous regulation of a superior agricultural technology that UN-based regulation already has made too expensive to be applied widely to developing countries' crops?
Sixth, this project of Codex (which operates on behalf of the UN's FAO and WHO, remember) makes a mockery of the UN's Millennium Development Goals -- especially the first, and most ambitious: "to eradicate extreme poverty and hunger" by 2015. That can't be accomplished without innovative technology, and there won't be innovative technology if it is regulated excessively and stupidly. FAO calls on one hand for greater allocation of resources to agriculture, and then makes those resources less cost-effective by gratuitous over-regulation of the new biotechnology. (Another UN initiative that has vitiated agricultural biotechnology is the "biosafety protocol" of the UN-based Convention on Biological Diversity, but that's another story.)
Other Millennium Goals inevitably will be compromised, directly or indirectly, by this Codex project (and by the "biosafety protocol" of the CBD). An important way, for example, to "reduce child mortality," the fourth goal, would be to produce childhood vaccines cheaply in edible fruits and vegetables, but there is near-hysteria at Codex over conjectural food-safety problems with this approach. Moreover, when the impoverished of the world are forced to spend more than necessary to grow or obtain food, fewer resources are available for other public health and environmental needs. As Wellesley College political scientist Robert Paarlberg has noted, the continued globalization of this sort of "highly precautionary regulatory approach" to gene-spliced crops will cause the "the biggest losers of all [to be the] poor farmers in the developing world," and "if this new technology is killed in the cradle, these farmers could miss a chance to escape the low farm productivity that is helping to keep them in poverty."
How about this for an additional Millennium Goal: Stop genocide-by-regulation by UN bureaucrats.
Finally, this sort of charade is exceedingly destructive to public sector research and development: Unscientific, overly burdensome regulation has raised costs to levels that "exclude the public sector, the academic community, from using their skills to improve crops," according to Dr. Roger Beachy, the director of the Danforth Plant Science Center in St. Louis. In effect, Codex and other UN regulatory initiatives have created a level playing field that is hip-deep in muck, a disadvantage to the best, brightest and richest in the field -- namely, American academics and companies.
The Codex deliberations are also disastrous politically. Unscientific, unduly burdensome Codex standards for biotech foods compromise hopes of World Trade Organization relief from protectionist policies in Europe and elsewhere. Codex standards provide cover for unfair trade practices, because with them in place, a country that wishes to block trade in gene-spliced foods for any reason can defend against charges of unfair trade practices simply by remonstrating that it's deferring to Codex.
So why is the United States going along with this travesty? At a meeting of our delegation, the representatives of USDA, EPA and FDA offered the following rationales: Because virtually every other country has in place irrational, unscientific regulation, we must, too; and anyway, we're really addressing trade, not scientific, issues. Most important, they said, American industry demands that we play along.
It is true that U.S. industry (dozens of whose lobbyists attended the Codex task force meeting, either as part of the U.S. delegation or as independent NGOs) reluctantly endorses the Codex process. Paul Green, from the Washington-based North American Grain Export Grain Association, seemed to represent the consensus of American industry, "We're trying to make the best of a lose-lose situation." But encouraging bad regulation is like eating your seed corn: a short-term expedient, a long-term catastrophe.
As a scientist, policy wonk, former federal regulator and taxpayer, I find the United States's complicity in this corrupt UN-based activity profoundly disturbing. American officials now regularly participate in and encourage these anti-scientific debacles, and the United States provides 22 percent of the base budget of the UN. Moreover, at this Codex task force meeting, U.S. officials tried (with little success, fortunately) to cozy up to their counterparts in the European Community delegation; on regulatotry issues, that is tantamount to the Department of Justice collaborating with the Mafia on the implementation of the Federal Witness Protection Program.
John Bolton and Condi Rice take note: Thanks in large part to flawed public policy, agbiotech already is moribund in the U.S. (and international) public sector, little better in industry, and dead and buried in the developing world. It's time to stop the hemorrhaging. The United States should cut off funding and all other assistance to foreign governments, United Nations agencies, and other international bodies that implement, collude, or cooperate in any way with unscientific policies. Flagrantly unscienttific regulation should become the "third rail" of American foreign policy.
U.S. government delegates to international bodies such as Codex, Food and Agriculture Organization, World Health Organization, United Nations Environment Program and UNESCO should be directed to defend rational, science-based policies, and to work to dismantle politically motivated, unscientific restrictions.
Uncompromising? Aggressive? Likely to ruffle feathers? Yes -- but justified in the face of the virtual annihilation of entire areas of research and development, disuse of a critical technology, further disenfranchisement of poor countries, and disruption of free trade.
Let's get public policy out of The Twilight Zone before it's too late. (Cue Twilight Zone theme music.)
Henry I. Miller, a fellow at the Hoover Institution, was the founding director of the Office of Biotechnology at the FDA, 1989-1993. He is an advisor to the U.S. delegation to the Codex task force on biotech foods. Barron's selected his most recent book, "The Frankenfood Myth," as one of the 25 Best Books of 2004.

China seeks boost from biofuels
September 30, 2005
Bloomberg News
Koh Chin Ling
China is, according to this story, turning to crops including cassava roots and molasses to make auto fuel as the world's second-biggest oil user struggles to meet demand from a growing fleet of private cars.
Li Bei, deputy general manager, was cited as saying in an interview that China Resources Alcohol (Heilongjiang) may build a 600 million yuan, or $74 million, plant in Guangxi Province to turn cassava and molasses into fuel,. The company is one of the nation's four biggest grain-based ethanol makers, which aim to raise output of the gasoline substitute by 39 percent during the rest of this year.
The companies are turning to alternative crops like cassava, which is used to make tapioca. China's corn crop, the world's second-largest, may be 3 percent smaller this year, leaving less to feed citizens and less to turn into ethanol to be added to gasoline. That is forcing processors to seek new fuel substitutes after economic growth of 9.5 percent and soaring oil prices swelled the country's energy bill.
China's oil-import costs rose to $33.9 billion in 2004 as global crude prices rose to records. Private vehicle ownership has increased six-fold in 10 years, expanding gasoline use.

Irwin Schmidt receives CropLife Canada's chairman's award recognized for lifelong innovation in agri science industry
September 30, 2005
From a press release
TORONTO - Irwin Schmidt, Director Regulatory Affairs, United Agri Products Canada received the Chairman's Award from CropLife Canada at the 53rd Annual Conference in Niagara Falls. The award recognizes his contributions to the industry leading and initiating in working with various government regulatory agencies and departments as well as farm and retailer stakeholders. The Chairman's Award was introduced in 1993 to recognize a member who has made an outstanding contribution to the objectives of CropLife Canada during the past year.
"Irwin's years of tireless commitment and contribution to CropLife Canada, as well as to the industry as a whole make him well deserving of this award," commented Jay Bradshaw, Chair of the Board of Directors of CropLife Canada. "The 2005 Chairman's Award recognizes outstanding achievement in our industry, and I am very pleased to award it this year to Irwin" Each year, candidates are presented to the Executive Committee for selection. Criteria include, but are not limited to, contributions and initiatives, time devoted to industry issues, enthusiasm, reduction in industry costs and a willingness to tackle new tasks. Among many other accomplishments, Irwin along with three other industry representatives was instrumental in initiating and implementing a local CropLife Council in Ontario and also the "safety in your hands" an education program aimed at farmers to reduce occupation exposure by wearing protective gloves.
"CropLife Canada is pleased to recognize Irwin's contribution over the years. He has been invaluable to the entire crop protection industry," said Lorne Hepworth, President, CropLife Canada. CropLife Canada is the trade association representing the manufacturers, developers and distributors of plant science innovations - pest control products and plant biotechnology - for use in agriculture, urban and public health settings.
CropLife Canada's mission is to support innovative and sustainable agriculture in Canada, in cooperation with others, by building trust and appreciation for plant science innovations.

Mexican fruit fly; quarantined areas and treatments for regulated articles
September 30, 2005
[Federal Register: (Volume 70, Number 189)]
[Page 57122-57124]
[DOCID:fr30se05-2] 7 CFR Part 301
[Docket No. 02-129-5]
AGENCY: Animal and Plant Health Inspection Service, USDA.
ACTION: Affirmation of interim rules as final rule.
SUMMARY: We are adopting as a final rule, without change, an interim rule that amended the Mexican fruit fly regulations to provide for the use of irradiation as a treatment for fruits listed as regulated articles. We are also adopting as a final rule, without change, an interim rule that amended those regulations by removing a portion of San Diego County , CA , from the list of quarantined areas. Those interim rules were necessary to provide an additional option for qualifying regulated articles for movement from quarantined areas and to relieve restrictions that were no longer needed to prevent the spread of Mexican fruit fly to noninfested areas of the United States . DATES: The interim rules became effective on February 20, 2003 , and October 22, 2003 .
FOR FURTHER INFORMATION CONTACT: Mr. Wayne Burnett, National Fruit Fly Program Manager, PPQ, APHIS, 4700 River Road Unit 134, Riverdale, MD 20737-1236; (301) 734-4387.

West Indian fruit fly; regulated articles
September 30, 2005
[Federal Register: (Volume 70, Number 189)]
[Page 57121-57122]
[DOCID:fr30se05-1] This section of the FEDERAL REGISTER contains regulatory documents having general applicability and legal effect, most of which are keyed to and codified in the Code of Federal Regulations, which is published under 50 titles pursuant to 44 U.S.C. 1510. The Code of Federal Regulations is sold by the Superintendent of Documents. Prices of new books are listed in the first FEDERAL REGISTER issue of each week.
[[Page 57121]] DEPARTMENT OF AGRICULTURE Animal and Plant Health Inspection Service
7 CFR Part 301
[Docket No. 04-127-2] AGENCY: Animal and Plant Health Inspection Service, USDA.
ACTION: Affirmation of interim rule as final rule.
SUMMARY: We are adopting as a final rule, without change, an interim rule that amended the West Indian fruit fly regulations by removing grapefruit, sweet lime, sour orange, and sweet orange from the list of regulated articles. A review of available scientific literature and other information led us to conclude that these citrus fruits do not present a risk of spreading West Indian fruit fly. This action affirms the elimination of restrictions on the interstate movement of these citrus fruits from areas quarantined because of the West Indian fruit fly. DATES: The interim rule became effective on April 26, 2005 .
FOR FURTHER INFORMATION CONTACT: Mr. Wayne D. Burnett, National Program Manager, PPQ, APHIS, 4700 River Road , Unit 134, Riverdale , MD 20737-1236 ; (301) 734-4387.

Citrus from Peru
September 30, 2005
[Federal Register: (Volume 70, Number 189)]
[Page 57206-57213]
[DOCID:fr30se05-50]
This section of the FEDERAL REGISTER contains notices to the public of the proposed issuance of rules and regulations. The purpose of these notices is to give interested persons an opportunity to participate in the rule making prior to the adoption of the final rules. [[Page 57206]] e 7 CFR Part 319 [Docket No. 03-113-2]
AGENCY: Animal and Plant Health Inspection Service, USDA.
ACTION: Proposed rule. SUMMARY: We are proposing to amend the fruits and vegetables regulations to allow the importation, under certain conditions, of fresh commercial citrus fruit (grapefruit, limes, mandarin oranges or tangerines, sweet oranges, and tangelos) from approved areas of Peru into the United States . Based on the evidence in a recent pest risk analysis, we believe these articles can be safely imported from Peru , provided certain conditions are met. This action would provide for the importation of citrus from Peru into the United States while continuing to protect the United States against the introduction of plant pests. DATES: We will consider all comments that we receive on or before November 29, 2005 .
ADDRESSES: You may submit comments by any of the following methods: EDOCKET: Go to http://www.epa.gov/feddocket to submit or view public comments, access the index listing of the contents of the official public docket, and to access those documents in the public docket that are available electronically. Once you have entered EDOCKET, click on the �View Open APHIS Dockets� link to locate this document. Postal Mail/Commercial Delivery: Please send four copies of your comment (an original and three copies) to Docket No. 03-113-2, Regulatory Analysis and Development, PPD, APHIS, Station 3C71, 4700 River Road Unit 118, Riverdale , MD 20737-1238 . Please state that your comment refers to Docket No. 03-113-2. Federal eRulemaking Portal: Go to http://www.regulations.gov and follow the instructions for locating this docket and submitting comments. Reading Room: You may read any comments that we receive on this docket in our reading room. The reading room is located in room 1141 of the USDA South Building , 14th Street and Independence Avenue SW., Washington , DC . Normal reading room hours are 8 a.m. to 4:30 p.m. , Monday through Friday, except holidays. To be sure someone is there to help you, please call (202) 690-2817 before coming. Other Information: You may view APHIS documents published in the Federal Register and related information on the Internet at http://www.aphis.usda.gov/ppd/rad/webrepor.html

#4150

From: Doug Powell <dpowell@...>
Date: Mon Oct 3, 2005 11:15 pm
Subject: Agnet Oct. 3/05

dpowell@...