...although I hate appending to other peoples mail (looks confusing after the
fourth
iteration), I couldn't resist....

Rafe wrote:

> > Who here considers themselves a biohacker?
> > Why?
>
>     <disclaimer>  I'm not a biologist, nor a geneticist.  </disclaimer>  I'm a
> recreational hardware tinkerer with aspirations of living to see and
participating
> in the artificial enhancement of consenting people using whatever means the
coming
> years develop - cybernetics, now the genome, whatever comes next.  Wetware,
> hardware, nanoware, what have you.
>

I am a chemist with at strong biotechnology background, and would therefore
always be
someone to put a damper on things and sound very pessimistic.  I think the time
where
(efficient) molecular biology becomse cheap enough to do in your own kitchen
(more
about THAT later on) still lies 5 to 10 years in the future... but why restrict
yourself to your own kitchen?

> > *What is that ethic and how are they going to express it?
>

Ethics are so flexible and wishy-washy... I try living with my own
conscience...that
is hard enough

> > *Once we finally get around to teaching ourselves how to do genetics in our
> > kitchen (while we are building computers in our garages)
>
>     egads!  you don't build pc's in the garage - you do it in the living room,
you
> philistine! *big grin*  less dust, for one thing. . . and where would you work
on
> the car if you did that? *g*
>
>     besides, i would be singularly uncomfortable working on anything in my
> kitchen. . . those things i am unable to eat may develop into something
predatory
> while i'm otherwise engaged under the prevailing conditions *chuckle*
>

As I said, (efficient) genetics in your own kitchen might take a while yet...
and I
have to agree that the kitchen is definitely NOT the best place to do this...
seeing
how you would be working with living organism at most times, numerous harmful
chemicals, etc. it would be best to set a room apart for this... a CLEAN room
preferably, because a kitchen is not a clean place (mine isn't)... you don't
want to
botch up your 6 weeks of experiments to discover that the thing growing in your
petri
dishes is the same as the stuff growing on your bread... (it is a thing about
competition... molds, bacteria and other critters found in the kitchen are the
pinnacle of evolution when it comes to survival... )

> > *Do we want genetic information to be free (a traditional hacker ethic)? 
Are
> > we willing to take the consequences of that decision?
>
>     Responsibility in all things is in the hands of those who wield
technology,
> not those who create it.
>
>     General Motors doesn't go on trial when a drunk driver has an accident. 
Smith
> & Wesson is not tried in a drive-by shooting.  Linus Torvalds is not at fault
when
> a Linux-using script kiddie compromises a domain.
>

First of, genetic information is generally freely accessible... if you think you
can
work with ggaatcctctggatctgatgcaa, etc., ad infinitum.  The "real genetics",
meaning
plasmids, strains, etc. is mostly "hardware" so you would have to "snail mail"
them...
barring you are violating quarantine laws, that shoudn't be a problem.Secondly ,
I
disagree with the GM analogy... or how come smokers are now sueing (and winning)
against the tobacco industry... the problem is (I agree) one of responsiblity...
and
you cannot enforce or control that (as I said, each his own conscience)

>     Hamstringing research and learning by presenting the spectre of "What
could
> people do ill with this?" strikes me as counterproductive.  I may be in the
> minority by taking this stance, but I think that, as with almost all human
> inventions, there is a greater potential good with unfettered possibilities
than
> when artificial limits are imposed.
>

I agree.  Vehemently.

>     There will always be cretins who will want to do bad things with any tool
at
> hand.  The trick is to have a defense against such actions ahead of time.  Not
> always possible or practical, but it's a thought.  Perhaps someone with a
better
> grasp on the implications of what's to be happening here can shed more light
on
> the subject?
>

It is bascially the same problem, responsiblity and the scientist, application
and
pure research. Atomic bombs in third world countries (..is here a nuclearhacking
newsgroup?)... the discussion on this are endless..

> > *Do we dare ever dare to do ethically or legally questionable work?
>
>     YMMV, but I suspect that a) not all of us share the same set of ethics
100%,
> and b) a great many laws, while not yet obsolete or farcical, will certainly
> become so.
>

...and then again, if you don't get caught, who will know.  Sorry, but I think
we are
getting ahead of ourselves a bit.  I think what is necessary is a solid
groundwork.
Then you can "work on genetics in your kitchen" and then (much later) something
useful/interesting/dangerous will come out of it.  I think we should provide a
bit
know-how support (..what happens if, how come...etc.) and look into ways of
implementing stuff in the "kitchen" (i.e. how to build a centrifuge, how to work
properly in a semi-sterile environment, etc.)

> > *How do we do all of this without letting 'biocrackers', people who abuse
> > genetics, from developing?
>
>     See above, but it's all but inevitable, IMHO.  A solid framework of
> considering the applications and how to countermand the crackerish
implementations
> of the developed technology is something I think we'll all have to deal with
and
> give thought to. *sigh*
>

...bit early for that (at least on the amateur level, governments have their own
biocrackers, oh, sorry, biological weapons researchers).

> > *How and where do we compile information about our discoveries?
> >     Thoughts: Web pages, mailing lists, hardcopies
>

...here?

> > *How do we go about our testing procedures?
> >     Thoughts:  Rats, human volunteers (legal?), microbial colonies
>
>     I would certainly be willing to volunteer, within reason (ie: low chance
of,
> oh, death *smiles*).
>

I wouldn't volunteer... death could be the smallest problem... BTW if you could
specify what "procedures" it would be easier to see about testing them

> > *What is the level of cooperation between members of this group?
>
>     Whatever each individual is willing to contribute, I should think.  Again,
I'm
> also new here, and have a penchant for being given to fits or optimistic
naivite.
> *laugh*
>
> > Or are we all rogue, brilliant and driven individualists?
>
>     Were that the case, would such an individual be on this list and
contribute?
> (wait, that was circular and rhetorical.  neverming *g*)
>
>     I think, by and large, that's a given, given the content.  But cooperation
> would seem to be prevalent, unless I'm working under a badly flawed set of
> assumptions. *smiles*
>

I agree.  Personally I put myself in the "brilliant" category, though there are
a lot
of differing opinons on that :-)

Hope that muddles the waters a bit...



akb

Jacob Sprunck wrote:

> Hello, I just found this group a  couple of days ago and thought 'oh neat, a
> group on biohacking'.  I don't know much about genetics, really, but it simple
> to see its current and future importance.

     </lurk>  I am in a similar situation.  Hello, World.

> Who here considers themselves a biohacker?
> Why?

     <disclaimer>  I'm not a biologist, nor a geneticist.  </disclaimer>  I'm a
recreational hardware tinkerer with aspirations of living to see and
participating
in the artificial enhancement of consenting people using whatever means the
coming
years develop - cybernetics, now the genome, whatever comes next.  Wetware,
hardware, nanoware, what have you.

     I figured this would be a good place to queue up to become Borg *chuckle*

> *If people in this group call themselves biohackers, do they have the hacking
> ethic?

     I suspect that's a given.  Think back to the earliest days of ARPANET - most
participants were hackers, not crackers (forays into grey areas based on
curiosity
notwithstanding *s*).  The field is, I believe, nascent enough that it's almost
entirely composed of people who are either actively working to push back the
frontier, chronicle that action, or are interested in watching and perhaps
offering suggestions (while lacking the technical savvy to participate).  I
myself
fall into the third category, and am more or less a hopeful sounding-board for
the
more proficient constituents, provided the opportunity presents itself.

> *What is that ethic and how are they going to express it?

     See http://www.tuxedo.org/~esr/jargon/html/entry/hacker-ethic.html

     I think I put my opinion of this above - looking around and tinkering to see
what's there to be played with; research and learning as it's own reward.  The
commercial, political, and medical considerations would be, I think, secondary
to
simply finding out what's in there and rooting around.  But I'm hardly the
best-qualified participant here to answer that.

> *Once we finally get around to teaching ourselves how to do genetics in our
> kitchen (while we are building computers in our garages)

     egads!  you don't build pc's in the garage - you do it in the living room,
you
philistine! *big grin*  less dust, for one thing. . . and where would you work
on
the car if you did that? *g*

     besides, i would be singularly uncomfortable working on anything in my
kitchen. . . those things i am unable to eat may develop into something
predatory
while i'm otherwise engaged under the prevailing conditions *chuckle*

> *Do we want genetic information to be free (a traditional hacker ethic)?  Are
> we willing to take the consequences of that decision?

     Responsibility in all things is in the hands of those who wield technology,
not those who create it.

     General Motors doesn't go on trial when a drunk driver has an accident. 
Smith
& Wesson is not tried in a drive-by shooting.  Linus Torvalds is not at fault
when
a Linux-using script kiddie compromises a domain.

     Hamstringing research and learning by presenting the spectre of "What could
people do ill with this?" strikes me as counterproductive.  I may be in the
minority by taking this stance, but I think that, as with almost all human
inventions, there is a greater potential good with unfettered possibilities than
when artificial limits are imposed.

     There will always be cretins who will want to do bad things with any tool at
hand.  The trick is to have a defense against such actions ahead of time.  Not
always possible or practical, but it's a thought.  Perhaps someone with a better
grasp on the implications of what's to be happening here can shed more light on
the subject?

> *Do we dare ever dare to do ethically or legally questionable work?

     YMMV, but I suspect that a) not all of us share the same set of ethics 100%,
and b) a great many laws, while not yet obsolete or farcical, will certainly
become so.

> *How do we do all of this without letting 'biocrackers', people who abuse
> genetics, from developing?

     See above, but it's all but inevitable, IMHO.  A solid framework of
considering the applications and how to countermand the crackerish
implementations
of the developed technology is something I think we'll all have to deal with and
give thought to. *sigh*

> *How and where do we compile information about our discoveries?
>     Thoughts: Web pages, mailing lists, hardcopies

     *paints a large YOU ARE HERE sign on a sandwich-board and hangs it on Jacob*
(*grins*)

> *How do we go about our testing procedures?
>     Thoughts:  Rats, human volunteers (legal?), microbial colonies

     I would certainly be willing to volunteer, within reason (ie: low chance of,
oh, death *smiles*).

> *What is the level of cooperation between members of this group?

     Whatever each individual is willing to contribute, I should think.  Again,
I'm
also new here, and have a penchant for being given to fits or optimistic
naivite.
*laugh*

> Or are we all rogue, brilliant and driven individualists?

     Were that the case, would such an individual be on this list and contribute?
(wait, that was circular and rhetorical.  neverming *g*)

     I think, by and large, that's a given, given the content.  But cooperation
would seem to be prevalent, unless I'm working under a badly flawed set of
assumptions. *smiles*

> (I think I'll go watch GATTACA now...)

     But, please, if you post on /., =don't= sound like Jon Katz *grin*  One
verbose Chicken-Little of the Genome is plenty, thankyouverymuch.

<lurk mode=disabled>

-Rafe

"When in doubt, get more hardware.
If that doesn't help, at least you end up with more hardware."
     - Thresh
                    [=/////  AGP SPF 91  \\\\\=]

(I hope that this doesn't come across as too far off topic for a tech
orientated group)

Hello, I just found this group a  couple of days ago and thought 'oh neat, a
group on biohacking'.  I don't know much about genetics, really, but it simple
to see its current and future importance.  The infrastructures and basic
technologies of consumer and industrial genetics are being developed more and
more rapidly every day.  Well, I don't want to let all of that
pass me by, or leave me a confused and reactive consumer, standing ignorant on
the outside purchasing black box technologies.  Hence, I have joined this
group.

Now I am mulling and thinking about biology, hacking and this group; what it
means and what it could mean.  And, well, I have to ask a few questions:

Who here considers themselves a biohacker?
Ok, thanx for the show of hands.

Now then, my second question:

Why?

And of course with two questions, I can't stop there:

*What is setting us apart from being just an (amateur/professional)
biologist?
*If people in this group call themselves biohackers, do they have the hacking
ethic?
*What is that ethic and how are they going to express it?
*Do this group have a goal, a mode of operation?
*Once we finally get around to teaching ourselves how to do genetics in our
kitchen (while we are building computers in our garages), do we take those
methods and distribute it to any yahoo that comes along? Do we hoard it?  Do
we sell it?
*Do we want genetic information to be free (a traditional hacker ethic)?  Are
we willing to take the consequences of that decision?
*Do we ever reverse engineer the products of a company (a traditional hacker
pastime)?
*Do we dare ever dare to do ethically or legally questionable work?
*How do we do all of this without letting 'biocrackers', people who abuse
genetics, from developing?

Moreover, there are questions in my minds about the technical aspects of being
a biohacker:
*Are we all trying to give ourselves labs at home, in the kitchen? Suitcase
laboratories?
     Thoughts: we need to identify and list the common tools of the geneticist
and molecular biologist, and then get creative.
*How and where do we compile information about our discoveries?
     Thoughts: Web pages, mailing lists, hardcopies
*How do we go about our testing procedures?
     Thoughts:  Rats, human volunteers (legal?), microbial colonies
*What is the level of cooperation between members of this group?
     Thoughts:  I don't really have much in the way of a home, and so can't
really set up my own lab.  But I live in Berkeley and have access to some of
the best library facilities in the world.  I would be happy to do several
hours of reading and research a week, assisting somebody who had better
facilities than I.  Or are we all rogue, brilliant and driven individualists?
*How the hell do we deal with the legal reprecussions?
      Thoughts:  Anybody know a good lawyer?

And of course, the big question:
Are my questions worthwhile, or am I bringing a bunch of silly thoughts to a
group of people who are just trying to have fun and learn a little bit more
about genetics (biorecreationist?  genefoolery?)

Ciao
Jacob "Wordy" Sprunck

(I think I'll go watch GATTACA now...)

____________________________________________________________________
Get free email and a permanent address at http://www.netaddress.com/?N=1

I think the sequencing of the human genome is a tremendous technological

accomplishment, but its impact on human history is largely symbolic.
Biotechnology
in general is an amazing advancement, in all its manifestations, both
medical and
agricultural. The sequencing of the human genome provides us with the
information
we would need in order to apply biotechnology to humans, but the
technologies
needed to do so have been developed over the past 30 years, and will
continue being
developed for decades more. The ability to clone a human being may be within
our grasp,
but the genetic code itself is only tangentially related to cloning (they
didn't need to have an
entire sheep genome sequenced to clone a sheep). It is the sum total of all
these
technologies which represents a milestone in human history. Nevertheless,
with a complete
sequence in hand, we are much closer to understanding how that sequence
functions
to create a human being.

-Theresa Klein

Christopher McKinstry wrote:

> Tomorrow is the most important day in human history thus far. Tomorrow
> is the day that the Human Genome is officially declared as sequenced;
> the day we first possess the computer program that makes us human.
>
> I would like to invite each of you subscribing ArConDev and BioHacking
> to make a posting describing what you think about this accomplishment
> and what it will bring us in the future.
>
> Chris McKinstry
> Moderator, ArConDev and BioHacking
> http://www.mindpixel.com/chris
>
> ------------------------------------------------------------------------
> Get a NextCard Visa, in 30 seconds!
> 1. Fill in the brief application
> 2. Receive approval decision within 30 seconds
> 3. Get rates as low as 2.9% Intro or 9.9% Fixed APR
> http://click.egroups.com/1/5200/13/_/712486/_/961984193/
> ------------------------------------------------------------------------
>
> Community email addresses:
>   Post message: biohacking@onelist.com
>   Subscribe:    biohacking-subscribe@onelist.com
>   Unsubscribe:  biohacking-unsubscribe@onelist.com
>   List owner:   biohacking-owner@onelist.com
>
> Shortcut URL to this page:
>   http://www.onelist.com/community/biohacking

Michael Van Vertloo wrote:

> ... Now that we have the DNA sequence for humans,
> the creation of humans loses a bit of its marvel (at least to those who
> don't quite realize what's involved here) - that it may possibly be done
> every day now.

...as a matter of fact, IT IS done everyday... although more on the biological
level :-)


akb

After having read the text of the 3rd secret, it seems nothing more than
mere coincidence.  The two appear to have nothing in common.

The only non-coincidental reason that comes to mind at all is that today
is a day where we marvel at what science has brought us.  It seems that
triumphs in science tend to always be in conflict with religion.  This
is one more such issue.  Now that we have the DNA sequence for humans,
the creation of humans loses a bit of its marvel (at least to those who
don't quite realize what's involved here) - that it may possibly be done
every day now.  The Vatican is simply reminding us that while we may
have the genome, we still don't have all the answers.



Christopher McKinstry wrote:
>
> is it a coincidence that the Vatican is reviling the 3rd secret of
> Fatima on the same day that the sequencing of the human genome is
> completed???
>
> ------------------------------------------------------------------------
> Get a NextCard Visa, in 30 seconds!
> 1. Fill in the brief application
> 2. Receive approval decision within 30 seconds
> 3. Get rates as low as 2.9% Intro or 9.9% Fixed APR
> http://click.egroups.com/1/5197/13/_/712486/_/962009721/
> ------------------------------------------------------------------------
>
> Community email addresses:
>   Post message: biohacking@onelist.com
>   Subscribe:    biohacking-subscribe@onelist.com
>   Unsubscribe:  biohacking-unsubscribe@onelist.com
>   List owner:   biohacking-owner@onelist.com
>
> Shortcut URL to this page:
>   http://www.onelist.com/community/biohacking

is it a coincidence that the Vatican is reviling the 3rd secret of
Fatima on the same day that the sequencing of the human genome is
completed???

Tomorrow is the most important day in human history thus far. Tomorrow
is the day that the Human Genome is officially declared as sequenced;
the day we first possess the computer program that makes us human.

I would like to invite each of you subscribing ArConDev and BioHacking
to make a posting describing what you think about this accomplishment
and what it will bring us in the future.


Chris McKinstry
Moderator, ArConDev and BioHacking
http://www.mindpixel.com/chris

> 3.  trying to morally and ethically support your actions... this is a biggy


you're right, this is the big issue and my largest concern.

we're getting close to the point where individuals can modify and
release organisms from their home labs. some us us can do it right now,
it's really just a matter of being able to spare about $20,000...

we're just a few years away of a living LOVEBUG!


i'm not sure how we're going to handle this... will we have to wear
space suits on our own planet? or will we have to abandon biology and
move into computers?

chris
http://www.mindpixel.com/chris

> Im specifically interested in this for the purpose of investigating
> the possibility of generically engineering organisms to survive
> in extremely harsh or bizarre environments.
> For example, taking a gene from a bacterium that survives in very
> cold conditions, and implanting it into a grass species to allow it
> to survive in the arctic.
>

I have also read the /. -referenced article and I think what you are trying
to do is a bit more than just "visualizing" DNA.It takes thousands of US$ and
tons of specialized skills to firstly:
1.  identify the gene in the bacterium (...most genes are not mapped to
functions yet, and even if they are, they might not be expressed under all
environmental conditions)
2.  remove that gene, put it on a plasmid, and put that plasmid into another
organism (this has been done for a long time at huge expenses between
bacteria... but taking genes from a bacterium and inserting it into a
plant... it is like trying to get a pig to do photosynthesis, theoretically
possible... but imagine what changes to the hosts metabolism would have to be
made additionally...)
3.  trying to morally and ethically support your actions... this is a biggy,
even if 1. and 2. work, would you really want to let your "creation" loose on
the environment. I am very pro biotechnology, but you do have to be careful.

> For starters I just want to know what I would need to do
> something like this in a home lab.
>

...oops, forgot the entire infrastructure in point 1., meaning sterile
benches, fume cupboards, centrifuges, etc., not considering that most
countries have very strict government regulations about who may work with the
genetic material to what extent.

I hope this doesn't sound too pessimistic, but things are a lot more
difficult (and expensive) when you try doing something like gene transfer as
opposed to "visiualizing DNA".

akb

In a message dated 6/23/00 8:51:18 PM Eastern Daylight Time,
tjk2@... writes:

<< For example, taking a gene from a bacterium that survives in very
  cold conditions, and implanting it into a grass species to allow it
  to survive in the arctic.  >>


     That's always been an interesting topic--but the cells living in those
extreme conditions generally aren't very efficient.  It's hard to imagine a
species in a less rarefied environment, like grass in a lawn, being able to
compete with any success.  Enzymes optimized for a normal temperature range
would seem to be the pivotal point here.

     Most of the supplies can be bought at places like Fisher Scientific and
Sigma-Aldrich.  Most companies these days will take credit cards.  Some good
sites for ideas on amateur scientific work are:

      <A HREF="http://www.sciam.com/2000/0700issue/0700amsci.html">Scientific
American: Feature Article: PCR at Home: July 2000</A>

      <A HREF="http://www.funsci.com/texts/wsites_en.htm">Amateur Scientist
Sites</A>

Dave.

Hi, I just signed up for this list through a link from slashdot,
in a thread on recombining DNA in the home (article in scientific
american).
Im specifically interested in this for the purpose of investigating
the possibility of generically engineering organisms to survive
in extremely harsh or bizarre environments.
For example, taking a gene from a bacterium that survives in very
cold conditions, and implanting it into a grass species to allow it
to survive in the arctic.

For starters I just want to know what I would need to do
something like this in a home lab.

Could someone point me towards a list of supplies and prices?

-Theresa

As reported on http://www.slashdot.org, Scientific American
(http://www.sciam.com) has published an amateur scientist article on PCR at
Home (http://www.sciam.com/2000/0700issue/0700amsci.html).

The article explains how to isolate your own DNA (with links to making a
centrifuge out of a blender) and then use the Polymerase Chain Reaction
(PCR) to amplify it.

The 'kit' offered contains all of the important reagents and enzymes ($40)
but I was unable to find it on the site.  I wonder what primers they are
using?

In any event, it's great to see such an important technology explained and
available to laypeople who don't have access to big laboratories....

-Andreas

---------------
Andreas Matern
622 Rhodes Hall
Cornell Theory Center
Ithaca, NY 14853

alm13@...
http://syntom.cit.cornell.edu/

Hi everyone, just joined...
Pri

Engineering plants to produce drugs gets a mention in the New York
Times.

See:
http://www.nytimes.com/library/national/science/051400sci-gm-crops.html

"The production of drugs in genetically altered plants -- called
molecular farming or biopharming -- seems poised to represent the next
wave in agricultural biotechnology. Until now, efforts have mainly been
directed at protecting crops from pests and improving the taste and
nutrition of food. "

WASHINGTON (Reuters) -- A couple of genes helped insects evolve from
leggy millipedes and boring worms into flies, beetles and fleas and
probably helped them become among the most numerous creatures on the
Earth, researchers said on Monday. When they suppressed the two genes in
beetle larvae, the grubs grew extra legs, although they did not work
well, Randy Bennett and colleagues at Brigham Young University in Provo,
Utah reported.


Full Text:
http://www.cnn.com/2000/NATURE/04/25/science.legs.reut/




Chris McKinstry
BioHacking Moderator
--
http://www.mindpixel.com/chris

Selfish Gene Theory Of Evolution Called Fatally Flawed

The "selfish gene" theory proposed by Richard Dawkins has been an
influential thread in scientific and popular thinking for the past 25
years. The key concept is that any action is a supremely self-serving
one on the part of the actor, devoid of motivation to serve the larger
group to which the actor belongs (i.e., genes as parts of an organism).


Full Article:
http://unisci.com/stories/20002/0425001.htm


Chris McKinstry
BioHacking Moderator
--
http://www.mindpixel.com/chris

Using Models To Explore Regulation Of Gene Expression

If every cell in your body contains the same identical DNA, why are the
cells in your retina different from the cells in the palm of your hand?

The answer lies in the regulation of gene expression, says Chip Lawrence, a
research professor in the Computer Science Department at Rensselaer
Polytechnic Institute (RPI).

Full Text at: http://unisci.com/stories/20002/0418005.htm

Chris McKinstry
BioHacking Moderator
http://www.mindpixel.com/chris

In case you haven't seen it, check out:

DNA Learning Center http://vector.cshl.org


Chris McKinstry
BioHAcking Moderator
http://www.mindpixel.com/chris

Enter your vote today!  Check out the new poll for the biohacking
group:


I want to set up a molecular biology
lab at home.

   o Yes
   o No


To vote, please visit the following web page:

http://www.egroups.com/polls/biohacking

Note: Please do not reply to this message. Poll votes are
not collected via email. To vote, you must go to the eGroups
web site listed above.

Thanks!

Enter your vote today!  Check out the new poll for the biohacking
group:


I have extracted DNA from living tissue.

   o Yes
   o No


To vote, please visit the following web page:

http://www.egroups.com/polls/biohacking

Note: Please do not reply to this message. Poll votes are
not collected via email. To vote, you must go to the eGroups
web site listed above.

Thanks!

Salk Institute neuroscientists have obtained the first evidence that
specific genes control how the cortex forms functional units during
development. The cortex is the most recently evolved part of the mammalian
brain and, in humans, governs abstract reasoning and symbolic thought.

The study, published in the current issue of Science, sets the stage for
eventually understanding disorders of cortical development such as cerebral
palsy or schizophrenia.

"It's also the first genetic evidence to address a long-standing dispute
among neuroscientists," said Dennis O'Leary, Salk professor and senior
author of the study. "Many in the field thought that development of the
cortex was influenced solely by other parts of the brain, but our work shows
that genes within the cortex itself play a fundamental role."

For Full Story see: http://unisci.com/stories/20002/0414003.htm

Chris McKinstry
BioHacking Moderator
http://www.geocities.com/chrismckinstry

Celera announced Thursday that its researchers have identified all the
chemical letters that make up the genes of a human.


http://www.cnn.com/2000/HEALTH/04/06/genome.mapping/index.html


Chris McKinstry
BioHacking Moderator
http://www.geocities.com/chrismckinstry

Watching Gene Being Read During Transcription: A First

Scientists at Berkeley have reported the first direct observations of
what happens when the message of a gene is being read during the actual
transcription of single DNA molecules.

Using a unique experimental set-up they designed themselves, the
researchers followed transcription by single molecules of RNA polymerase
(RNAP), the enzyme responsible for reading the genetic message in humans
and other higher organisms as well as bacteria.

The full story can be read at:
http://unisci.com/stories/20001/0331003.htm



Chris McKinstry
BioHacking Moderator
http://www.geocities.com/chrismckinstry

Here are two great articles from Scientific American that can get you
started in BioHacking:

Spooling the Stuff of Life
http://www.sciam.com/1998/0998issue/0998amsci.html

Sorting Molecules with Electricity
http://www.sciam.com/1998/1298issue/1298amsci.html



If you havn't yet at least extracted DNA, you can't call yourself a
BioHacker... so get extracting!



Chris McKinstry
BioHacking Moderator
http://www.geocities.com/chrismckinstry

Now that we've hit 10 members, I think I'll try to get the ball
rolling...

Does anyone here have a lab set up?
Book recommendations?
Protocols?
Projects?
Ideas?

Myself, I haven't managed to do much other than extract DNA from plant
material. I get sort of mesmerized looking at the gigabytes of
information sticking to the end of a glass rod... can't wait to start
doing some sequencing... PCR, etc.


Chris McKinstry
BioHacking Moderator
http://www.geocities.com/chrismckinstry

My favorite commercial BioHacker, Craig Ventner's company, Celera
announced today that they have hacked the entire Drosophila genome
(actually just the euchromatin). It's nice to see that a large number of
the genes are conserved with humans... Nature is and object oriented
programmer!

It's also great to see Craig's shotgun sequencing method validated.

Way to go Craig!


Check it out:

http://www.celera.com/celerascience/homepage.cfm?object_name=News&parent_menu=Ne\
ws&objectid=/celerascience/news/pageone/article_fly_3_24.cfm

Chris McKinstry
BioHacking Moderator
http://www.geocities.com/chrismckinstry

You are all welcome to try out LabOnWeb:  http://www.labonweb.com

LabOnWeb is a collection of life science research tools to
enhance gene analysis and disovery, accelerate your work in
the lab and improve the accuracy of your experiment results.
LabOnWeb is noted and highly regarded for the scope of its
analysis, its proprietary data and tools and its delivery of
information.

The InstantRACE module elongates your query sequence, often
to a full-length gene. InstantRACE sequence elongation is
based in part on Compugen's LEADS discovery platform. LEADS
models complex phenomena, including alternative splicing,
sequencing errors, and intron contamination. It has been
used to predict thousands of new full-length genes and new
splice variants for known genes; the predictions have been
verified in the lab with a success rate of over 90%.

The comprehensive gene analysis report is based on a multiple
database search against all major public databases using the
most rigorous public and proprietary tools and algorithms.

In addition, LabOnWeb provides access to over 2 million
proprietary SAGE tags from Genzyme Molecular Oncology, thus
allowing an accurate quantitative tissue distribution profile
for your gene.

<<
  Friedreichs Ataxia is a genetic disease, for which the gene has been
  located, and there is a test to see if you have it, or are a carrier.  The
  following page has more info on current research for those interested:
   >>
I was DNA scanned for the presence of FDRA 2 yrs ago.  The test is like 4
years old.  When I was 14 and 15 I went thru some seriousy torture tests to
get diagnosed.  Big change, my first diagnosis for FDRA was more like a well
educated guess because there was no yes/no test.  I was DNA scanned with
850/1100 GAA repeats whch is positive for FDRA.  This is a physical
disability so that means I have a deceny IQ 101 and 102.  I got a decent mind
in a screwy body, that sux the worste about it all and there is pleanty of
us.  If any of you young scientific minds are intrested I can hook you up
with more ways for more percise info. I am intrested in the following:
  I'm not intrested at all in raising funds unless needed, I just wanna see a
change and get involved.  There is no animal(mice) research that I can find
here in the US for ataxia.  It needs to be.  National Ataxia Foundation(NAF)
is a, excuse my words, looser foundation.  They are just there to make an
ataxic patient feel comfortable because many believe our days are numbered as
well as painful.  Friedreich's Ataxia Reseach Assosiation(FARA) is quite new
and they are in the DC area, I get the feeling they are in it for a buck.
All of this should have been taken care of as a responsibility of an ataxian
or ataxians years ago, basically from the foudation NAF.  I now see their
ingnorance and see it is my responsibility now along with a few others.  Will
someone please help me see to this duty?

Russ White
Orlando, FL
  <A HREF="http://members.aol.com/rwtw128/mypage.html">My Autobiography</A>
"Do not suppose that, if you find something hard to achieve, it is beyond
human capacity; rather, if something is possible and appropriate for man,
assume that it must also be within your own reach." - Marcus Aurelius, _The
Meditations_

List moderators, please alow this.
Hi groups,
   My name is Russ White and I am 30.  I was diagnosed with a neurological
progressive disorder called Friedreich's Ataxia at 16.  At the time it did
not seem severe but due to it's progressiveness it is now.  In 1990 an
aquatence, also with FDRA, in the UK introduced animal research allowing Dr.
Pandollpho(sp?) to make his historical finding of how FDRA may work.
Furthermore he found the damaging effects by ''frataxin'' found only inside
the mitochondria of an FDRA patient.  I am no doctor or scientist, this is
all based on what I learned.  I also have personal beliefs but this is beside
the point.
    My aquatence in the UK asked me if I would be interested in introducing
animal(mice) research to the US for the benefit of ataxia.  My responce was
of course, ''yes.''  I began some research and found that it is a fact that
no animal research for ataxia is done in the US nor doe MDA provide animal
research for FDRA.  I also learned thru www.iiFAR.org that many disabled
communities do so such as, CP, Parkinson's, MS and so on.  No one with FDRA
or any other form of ataxia has taken the responsibility or given the effort
to see this research happen.  I remind you all how close science is to a
cure.  I'd like to become more involved in doing so primarily for the benefit
of ALL types of ataxia.  Of course ataxia is rare but some of us will do what
we can.  As of now I am stuck, my aquatence has given me a contact address.
I contacted him by email and phone but has not yet replied in 2 weeks, I have
no time to be a slacker.  Can someone please go about telling me where to
begin?


Russ White
Orlando, FL
  <A HREF="http://members.aol.com/rwtw128/mypage.html">My Autobiography</A>
"Do not suppose that, if you find something hard to achieve, it is beyond
human capacity; rather, if something is possible and appropriate for man,
assume that it must also be within your own reach." - Marcus Aurelius, _The
Meditations_